(Photo : Dr. Yesu Addepalli)

In addition to studying the complex chemical and physical properties of living things, dissecting their cellular structures, and understanding how they interact with different compounds, biochemists play a key role in providing the foundational knowledge and science used to develop health treatments and medical drugs.

Dr. Yesu Addepalli is a renowned expert in the field of biochemistry, having played a critical role in the drug discovery and synthesis of biologically active small molecules. This work has the potential to be revolutionary for the biopharmaceutical industry, as our society battles a wide variety of viruses and diseases. The PHD holder has a unique and valuable perspective thanks to his multifaceted education in organic chemistry, medicinal chemistry, and chemical biology.

Dr. Addepalli was instrumental in the development of antiparasitic drugs for leishmaniasis and trypanosomiasis. When asked about his methods, he explains: "My efforts were geared towards the utilization of chemical derivatization and forward genetic approaches to study a class of compounds that selectively test derivatives for selective activity on Leishmania tubulin and trypanosomatids. [From there, I] assessed their stability, solubility, cell permeability, and in vivo PK properties. [I] performed proof-of-concept testing in the mouse model of leishmaniasis and used a modular synthetic strategy, and Cryo-EM techniques to discover the binding site of a class of pyrimidinone derivatives. [Finally I] optimized promising agents for oral administration and performed dose response testing in animal models."

This work, at the University of Texas Southwestern Medical Center's Ready laboratory, will allow the development of compounds with a high therapeutic index for the treatment of trypanosomatid infections, based on the identification of molecules that inhibit targeting parasite tubulin polymerization. The newly found understanding of the drug target and mechanism brings promise for the treatment of these arthropod-borne diseases.

Dr. Yesu Addepalli earned his Master of Science degree in organic chemistry from the Government College (Autonomous), Rajahmundry in India before going on to complete his doctoral degree in organic chemistry under the guidance of Research Advisor Prof. Yun He at Chongqing University in China. Most recently, he has been working in a postdoctoral position with esteemed-researcher Professor Joseph Ready at the University of Texas Southwestern Medical Center, which provides him with both the tools and community to evolve and deepen his studies.

"I find bioactive small molecules to be fascinating. The design, synthesis, purification, and characterization of viruses and [their] treatment drugs are a wonder to behold, study, and develop." Dr. Addepalli shares, "Some people find beauty in the world around [them], but I see beauty in the microscopic world of viruses and find great pleasure in being instrumental in halting the spread of viruses through synthesizing biopharmaceuticals."

Although the work is rewarding,Dr. Yesu Addepalli recognizes that it is also a great responsibility, as each challenge is fundamentally a battle between life and death. He is grateful for the diversity of knowledge and skills that his team holds, as it brings them closer to streamlined bioactive molecule development. He is also currently collaborating with biologists at UT Southwestern, and elsewhere, using high-throughput screening strategies to discover small molecules with promising biological activity in an effort to identify compounds and molecules that will push the boundaries of genetic studies. The characterization of biologically active small molecules is a breakthrough for the development of novel therapeutics for neurodegenerative and infectious diseases, as well as for cancer.

Dr. Addepalli's esteemed work has been featured in a variety of reputable publications, and he also has a US patent for his team's work specifically with novel antiparasitic compounds and methods. He is an active member of the American Society for Biochemistry and Molecular Biology, as well as the Society for Immunotherapy of Cancer. In his free time, he also enjoys reviewing for publications such as Tetrahedron and Heterocyclic Chemistry.

His work revolves around molecules and compounds that are far too small to see with the naked eye, but the impact of his work has a very large scope. As our society has recently been reminded of the threat that these microscopic elements can bring, the work of Dr. Addepalli is perhaps more important than ever before. Gaining a stronger understanding of how these microscopic molecules create disease will help us to understand how to reverse and treat the disease. As they say, knowledge is power.

2022 TECHTIMES.com All rights reserved. Do not reproduce without permission.

Tags:

Continue reading here:
Expert In Biochemistry Dr. Yesu Addepalli Works On A Micro Level To Bring Macro Changes To The Development Of Novel Therapeutics - Tech Times

Home / News & Events / Be Open To A Lot of Things: A Brandeis Alums Advice on the Biochemistry & Biophysics Program

August 22, 2022

Sydney Adams | Graduate School of Arts and Sciences

Prior to receiving her PhD in Biochemistry & Biophysics from Brandeis, Karina Herlambang PhD22 studied biochemistry at the University of Wisconsin-Madison, where she worked for Brandeis alumnus Michael Cox PhD79 studying DNA repair mechanisms as a research assistant. She explains, I was still not sure what biochemistry was really all about, but, as time went on, my fascination towards all these proteins that made up who we are as a living organism only grew stronger. I knew that I wanted to spend more time doing research, so I decided to pursue a PhD. Cox spoke nothing but great things about Brandeis, and after speaking with other alums at UW Madison, Brandeis immediately became one of her top choices. She says Brandeis collaborative environment and top quality research along with our, close proximity to Boston, which is the biotech hub in the country helped to finalize her decision.

Herlambang says, The Brandeis community is just really wonderful! Everyone is willing to go above and beyond to help each other out. She went on to say, Every interaction that I had with the faculty at Brandeis has been really positive. She singled out Professor Jeff Gelles for particular praise, for playing a major role in my scientific and personal development. She partially credits her experience to the typically small class size at Brandeis which allowed her to get to know everyone pretty well. Her favorite part of the PhD program was the ability to collaborate with other lab groups from different departmentsnot just within Brandeis but also in other institutions. That really helped me to get helpful input and learn other techniques that otherwise I would not have been exposed to.

Herlambang made use of another Brandeis resource to secure her current role at Intellia Therapeutics. Working with the Professional Development team enabled her to receive crucial feedback on my resume and ask for interview tips. She also says that the Professional Development team initiated connections with Brandeis alums that currently work in some of the companies that I was applying for. Thats how I ended up applying to Intellia Therapeutics, she says. Little did I know, one of my interviewers was actually an alum of my lab, so that made the interview less intimidating.

While Herlambang cant share any of the projects she is currently working on at Intellia Therapeutics as a scientist in the RNA technologies group, she credits her time at Brandeis for helping her prepare for her role. Her work focuses on improving mRNA stability to enhance our gene editing platform. Herlambang says the scientific community at Brandeis challenged me to think critically and allowed me to be exposed to different areas of research. She went on to say that her experience at Brandeis, made me realize how important collaboration is and interdisciplinary research is even more evident in industry.

As for advice for students interested in pursuing a degree from Brandeis Biochemistry & Biophysics program, Herlambang says, Be open to a lot of things and start networking early. Exposing yourself to different areas of research or career path right from the beginning should help you figure out what you really want to do afterward. Being a Brandeisian itself is already a huge advantage. You might not be aware of this but you have this large network like the Brandeis alumni connection that you should take advantage of. It might be intimidating at first to reach out, but most people are willing to help.

Excerpt from:
Be Open To A Lot of Things: A Brandeis Alum's Advice on the Biochemistry & Biophysics Program - brandeis.edu

Experiments from the UNC School of Medicine lab of Nobel Prize-winning scientist Aziz Sancar, MD, PhD, show how a common molecular tool for DNA labeling also has anticancer properties worthy of further investigation, especially for brain cancers.

CHAPEL HILL, NC Scientists at the UNC School of Medicine have made the surprising discovery that a molecule called EdU, which is commonly used in laboratory experiments to label DNA, is in fact recognized by human cells as DNA damage, triggering a runaway process of DNA repair that is eventually fatal to affected cells, including cancer cells.

The discovery, published in the Proceedings of the National Academy of Sciences, points to the possibility of using EdU as the basis for a cancer treatment, given its toxicity and its selectivity for cells that divide fast.

The unexpected properties of EdU suggest it would be worthwhile to conduct further studies of its potential, particularly against brain cancers, said study senior author Aziz Sancar, MD, PhD, the Sarah Graham Kenan Professor of Biochemistry and Biophysics at the UNC School of Medicine and member of the UNC Lineberger Comprehensive Cancer Center. We want to stress that this is a basic but important scientific discovery. The scientific community has much work ahead to figure out if EdU could actually become a weapon against cancer.

EdU (5-ethynyl-2-deoxyuridine) is essentially a popular scientific tool first synthesized in 2008 as an analog, or chemical mimic, of the DNA building block thymidine which represents the letter T in the DNA code of adenine (A), cytosine (C), guanine (G) and thymine (T). Scientists add EdU to cells in lab experiments to replace the thymidine in DNA. Unlike other thymidine analogs, it has a convenient chemical handle to which fluorescent probe molecules will bond tightly. It thus can be used relatively easily and efficiently to label and track DNA, for example in studies of the DNA replication process during cell division.

Since 2008, scientists have used EdU as a tool in this way, as published in thousands of studies. Sancar, who won the 2015 Nobel Prize for Chemistry for his seminal work on DNA repair, is one such scientist. When his lab began using EdU, his team unexpectedly observed that EdU-labeled DNA triggered a DNA repair response even when it wasnt exposed to DNA-damaging agents, such as ultraviolet light.

That was quite a shock, Sancar said. So we decided to explore it further.

Following up on the strange observation, the team discovered that EdU, for reasons that are still unclear, alters DNA in a way that provokes a repair response called nucleotide excision repair. This process involves the removal of a short stretch of damaged DNA and re-synthesis of a replacement strand. This is the mechanism that repairs most damage from ultraviolet light, cigarette smoke, and DNA-altering chemo drugs. The researchers mapped EdU-induced excision repair at high resolution and found that it occurs across the genome, and it apparently occurs again and again, since each new repair strand includes EdU and thus provokes the repair response anew.

It had been known that EdU is moderately toxic to cells, though the mechanism of its toxicity had been a mystery. The teams findings strongly suggest that EdU kills cells by inducing a runaway process of futile excision repair, which ultimately leads the cell to terminate itself through a programmed cell-death process called apoptosis.

That discovery was interesting in its own right, Sancar said, because it suggested that researchers using EdU to label DNA need to take into account its triggering of runaway excision repair.

As we speak, hundreds and maybe thousands of researchers use EdU to study DNA replication and cell proliferation in lab experiments without knowing that human cells detect it as DNA damage, Sancar said.

Sancar and colleagues also realized that EdUs properties might make it the basis for an effective brain cancer drug because EdU becomes incorporated into DNA only in cells that are actively dividing, whereas, in the brain, most healthy cells are non-dividing. Thus, in principle, EdU could kill fast-dividing cancerous brain cells while sparing non-dividing, healthy brain cells.

Sancar and his team hope to pursue follow-up collaborations with other researchers to investigate EdUs properties as an anticancer agent.

Prior studies have already found evidence that EdU kills cancer cells, including brain cancer cells, but strangely, no one has ever followed up on those results, Sancar said.

Nucleotide excision repair removes thymidine analog 5-ethynyl-2-deoxyuridine from the mammalian genome was co-authored by Li Wang, Xuemei Cao, Yanyan Yang, Cansu Kose, Hiroaki Kawara, Laura Lindsey-Boltz, Christopher Selby, and Aziz Sancar. Funding was provided by the National Institutes of Health (GM118102, ES02755).

Media contact: Mark Derewicz, UNC School of Medicine, 919-923-0959

View post:
Scientists Discover Surprise Anticancer Properties of Common Lab Molecule | Newsroom - UNC Health and UNC School of Medicine

Newswise Researchers are exploring a potential new therapeutic approach for triple negative breast cancer treatment. Amir Abdo Alsharabasy, a CRAM doctoral candidate working in the laboratory of Professor Abhay Pandit, is working on the design of nitric oxide scavengers to form a new treatment approach for this aggressive form of breast cancer.

Triple-negative breast cancer is invasive breast cancer that does not respond to hormonal therapy medicines or the current medicines that target the HER2 protein. Triple-negative breast cancer is usually more aggressive, harder to treat, and more likely to recur than cancers that are hormone receptor-positive or HER2-positive.

Nitric oxide is one of the prominent free radicals produced by the tumor tissue, explains Amir, It, at certain concentrations, plays a significant role in breast cancer progression by inducing the cancer cells to spread to other parts of the body Our goal is to develop injectable hydrogel formulations, which can reduce the levels of, or scavenge the nitric oxide, while enhancing the generation of carbon monoxide, so that we can potentially design a new treatment approach for triple negative breast cancer.

Nitric oxide interacts with different components of the large network of proteins and other molecules that surround, support, and give structure to tumor cells and tissues in the body. Hyaluronic acid is one of the main components of this network and is the material of choice for fabricating these hydrogels.

HA plays multiple roles in tumour tissues says Amir. However, its interactions with nitric oxide have not been thoroughly investigated. The study, recently published inBiomacromolecules,attempts to understand the mechanism of these interactions and the different effects on nitric oxide levels and migration of breast cancer cells.

The study is supervised by Prof Abhay Pandit, Scientific Director of CRAM, and was published with collaborators Dr Sharon Glynn from the Lambe Institute for Translational Research and Dr Pau Farras from the School of Biological and Chemical Sciences in the Ryan Institute at the National University of Ireland Galway,

The work investigated the ability of HA to scavenge nitric oxide. The team found that the conversion of nitric oxide to certain nitrogen centred free radicals causes the HA to break down, which further inhibits the nitric oxide induced migration of cancer cells in the tumor environment.

Collectively, these results help toward understanding the involvement of HA in nitric oxide induced cell migration and suggests the potential use of modified HA, as a key material in different biomedical applications.

Commenting on the study, Professor Abhay Pandit, said: While the recent progress in research about the roles of nitric oxide with tumour progression resulted ultimately in a number of ongoing clinical trials for evaluating the effects of NO-synthase inhibitors, we are focusing on NO itself trying to avoid the side effects/reactions of these inhibitors.

Amir Abdo Alsharabasy received a BSc in Chemistry & Biochemistry, Mansoura University, Egypt, MSc in Biochemistry, Helwan University, Egypt and MSc in Biological and Bioprocess Engineering, Sheffield University, U.K. He spent some time working as a research assistant in Radiation Chemistry Department at NCRRT, Egypt. He was recently awarded two awards for his research. The first was a presentation award from the Second International Conference Therapeutic Applications of Nitric Oxide in Cancer and Inflammatory-related Diseases for his talk on the interactions between nitric oxide and hemin and their implications in the nitration of proteins in breast cancer cells. The second was an EMBO Scientific Exchange Grant to support a visit of the laboratory of Dr. Lasse Jensen in Linkping Univ., Sweden.

-ends-

Go here to read the rest:
Researchers use nitric oxide scavengers to target triple-negative breast cancer - Newswise

Protein expression and purification

Gene encoding the TPR domain of T. cruzi PEX5 (347668) was optimized for E. coli codon usage, synthesized by Integrated DNA Technologies (Coralville, USA) and cloned between NcoI and NotI restriction enzyme sites into petHSU vector. The resulting construct contained an N-terminal Hexa-histidine (His6) tag and a SUMO tag. For AlphaScreen the same gene was amplified using forward 5-TACGACCATATGGAAACCAATTATCCTTTTG and reverse 5-TACGACCTC GAGAACCGCCATGTCCTCCAAG primers and cloned into pET-24a(+) vector between NdeI and XhoI restriction sites resulting in a construct containing C-terminal His6-tag.

The relevant plasmid was transformed into E. coli BL21 (DE3). A single colony was inoculated in 50mL LB medium containing 10g/mL kanamycin and incubated overnight at 37C. 5mL of the preliminary culture were used to inoculate 500mL of LB medium supplemented with 50g/mL kanamycin and incubated at 37C. When the OD600 reached 0.8, the culture was cooled to 20C, induced with 1mM isopropyl -d-1-thiogalactopyranoside(IPTG) and the culture was continued overnight. The cells were then harvested by centrifugation and resuspended in lysis buffer containing 50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol, 40M AEBSF-HCL (protease inhibitor), 1g/mL DNAaseI and lysed on ice by sonication. The lysate was clarified by ultracentrifugation. The supernatant was applied to a HiTrap IMAC column pre-equilibrated with the lysis buffer and washed with abundant washing buffer (50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol). The His-SUMO tag was cleaved off overnight, directly on column, using dtUD1 protease. The flow-through was then collected, concentrated to 5mL using a 30kDa cutoff Amicon Ultra filter and applied to a size exclusion chromatography on High load S75 pre-equilibrated with 20mM Hepes pH 7.5, 100mM NaCl and 5mM -mercaptoethanol. 6-His-tagged TcPEX5 variant was concentrated to 5mL and further purified by size exclusion chromatography on High load S75 pre-equilibrated with PBS supplemented with -mercaptoethanol straight after being eluted from HiTrap IMAC column. The protocol yielded on average 30mg of TcPEX5 from 1L of bacterial culture.

Perdeuterated 15N-labelled TcPEX5 was expressed in M9 minimal medium prepared in D2O and containing 15N-ammoniun chloride as the sole nitrogen source. 5mL of preliminary culture were used to inoculate 500mL of the same medium. Cells were grown at 37C until the OD600 reached 0.8, the culture was cooled to 18C, induced with 1mM IPTG and maintained overnight. The pellets were collected and the protein was purified as described above. In the last step of purification, the protein was applied to a size exclusion chromatography on S75 pre-equilibrated with NMR buffer (50mM phosphate buffer pH 7.4, 150mM NaCl and 5mM -mercaptoethanol).

All FP measurements were performed on a multifunctional microplate reader (Tecan InfinitePro F200 plate) in Corning NBSblack 96-well or 384-well NBS microplates. 485-nm excitation and 535-nm emission filters were used. The FP values were calculated as follows:

$$FP=frac{{I}_{parallel }-{I}_{perp }}{{I}_{parallel }+ {I}_{perp }}$$

where ({I}_{parallel }) and ({I}_{perp }) are the emission light intensity parallel and perpendicular to the excitation light plane, respectively. Fluorescence polarization values were expressed in millipolarization units (mP).

In the FP saturation binding experiment, 10nM 6-FAM-labelled PTS1 (6-FAM-YQSKL) was mixed with increasing concentrations of TcPEX5 (0.1250nM) in FP buffer containing 10mM Hepes pH 7.5, 100mM NaCl and 5% DMSO. Each data point was determined in triplicate. The FP values were plotted against the log10 of the protein concentration, and the dissociation constant (Kd) was obtained by fitting the experimental data using an equation representing a one site non-cooperative ligand binding:

$$FP={FP}_{min}times frac{left({FP}_{max}- {FP}_{min}right)times c}{{K}_{d}+c}$$

where FP is the determined value of the fluorescence polarization, FPmin is the value of the fluorescence polarization of the peptide alone, FPmax is the maximum value of the fluorescence polarization (saturation), Kd is the dissociation constant and c is the protein concentration.

Competitive binding experiment was performed at 10nM 6-FAM-labeled PTS1 and TcPEX5 concentration yielding f0=0.8 according to Huang18. An in-house 30,000 molecules diversity set (ChemBridge, ChemDiv, Enamine, PPI) and FDA-approved drug library were used in high throughput screening. The selection criteria for the diversity libraries are: (i) diversity within each library and between the 3 diversity sets; (ii) MW<600g/mol; (iii) compounds with acceptable logS/logP for solubility; (iv) Lipinskis rule of 5; (v) Purity>90%. Reactive, unstable and toxic chemical groups, chemotypes of known acute or chronic toxicity and trivial compounds present in commercial random libraries have been filtered out. Each tested compound (50mM in DMSO) was transferred into each well of 384-well assay plate with a robotic delivery system. Mixtures containing 30nM TcPEX5 and 10nM 6-FAM-PTS1 were dispensed into the compound containing wells with a reagent dispenser. In each assay plate, DMSO and unlabeled PTS peptide were used as negative and positive controls, respectively. Wells containing 10nM 6-FAM-PTS1 only were used as additional controls. The inhibitory activities were calculated using the following equation: %Inhibition=100(mPnmPs)/(mPnmPp); where mPn, mPp, and mPs represent FP values of the negative controls, positive controls, and compound samples, respectively.

Prior to HTS the assay performance was evaluated using Z test according to19:

$${Z}^{{prime}}=frac{1-(3{SD}_{n}+3 {SD}_{p})}{{mu }_{n}-{mu }_{p}}$$

where SDn and SDp are the standard deviations, and n and p represent the means of the FP values obtained from the negative and positive controls, respectively. For this test each 384-well plate contained 190 negative control wells (labelled peptide and protein), 190 positive control wells (labeled peptide, protein, and unlabeled PTS1), and four 6-FAM-PTS1 only wells. All experiments were repeated three times.

1H, 15N heteronuclear single quantum coherence (HSQC) spectra were measured for uniformly perdeuterated 15N-labeled TcPEX5 (120M) in the absence or presence of ligands at 1:1 protein:ligand molar ratio. 10% (v/v) of D2O was added to the samples to provide the lock signal. Water suppression was carried out using the WATERGATE sequence20. All spectra were recorded at 298K using a Bruker Avance 600MHz spectrometer with a cryogenic TCI probehead. 1H15N heteronuclear correlations were obtained using the SOFAST-HSQC experiment21. Spectra were processed and visualized using TopSpin 4.0.2.

AlphaScreen assay was used as an orthogonal assay to test the ability of compounds of interest to dissociate PEX5PTS1 interaction. 100nM N-His-PEX5 was mixed with 50nM biotinylated PTS1 (YQSKL) in a PBS buffer supplemented with 5mg/mL of BSA and 0.01% (v/v) Tween-20. 5g/mL of streptavidin donor beads and 5g/mL of nickel chelate acceptor beads (PerkinElmer) were added to the mixture. For EC50 determination, serial dilutions of the inhibitors prepared in DMSO were added while keeping constant concentration of DMSO at 5% (this concentration was shown to have no effect on the assay readout). Signal was determined according to the bead manufacturer instructions. Data were analyzed using Origin Pro 9.0. Experimental points were interpreted using Hill sigmoidal fitting fixing the asymptotes at the maximal assay signal (no inhibitor added) and 0, respectively.

The trypanocidal activity of tested compounds was evaluated against T. brucei brucei bloodstream form (BSF) using resazurin-based 96-well plate assay. T. b. brucei BSF (Lister 427, MITat 1.2) parasites were grown in HMI-11 medium containing 10% fetal bovine serum (FBS) at 37C at 5% CO2. 1:1 serial dilutions (10 points) were prepared in quadruplicates for each compound in HMI-11 medium (100L/well). Additionally, each row contained a well without a compound and one with medium solely as controls. 100L of parasite cultures (4103/mL) were inoculated in all wells (except the control with medium alone) so that the final concentration of parasites was 2103/mL. The plates were incubated for 66h. 25L of 0.1mg/mL resazurin (in Hanks Balanced Salt Solution) was added to each well and further incubated till 72h timepoint. The reduction of resazurin was detected by following the fluorescence emission at 585nm (excitation 530nm) using a Synergy H1 microplate reader. The fluorescence emission of the well containing medium only was considered as background and subtracted from the fluorescence emission of other wells; then the percent survival values were calculated setting the fluorescence emission of the well without the compound at 100% survival. Experimental data points were fitted with a non-linear regression using GraphPad (6.04) and the half-maximal inhibitory concentration (IC50) values were derived from the corresponding sigmoidal doseresponse curves.

Original post:
Small molecule mediated inhibition of protein cargo recognition by peroxisomal transport receptor PEX5 is toxic to Trypanosoma | Scientific Reports -...

Bhopal: Though the Madhya Pradesh government has taken a path-breaking decision to start MBBS course in Hindi from the 2022-2023 academic session, experts in the medical field have expressed reservations over the move because of unavailability of quality books in the language on the subject.

Chief Minister Shivraj Singh Chouhan recently announced that from the new academic session, the Bachelor of Medicine and Bachelor of Surgery (MBBS) course will be taught in Hindi at the Bhopal-based Gandhi Medical College (GMC) to first year students.

Currently, medical education is imparted only in English.

Besides, Chouhan also announced that BTech degree and polytechnic diploma courses, in six colleges each, will be taught in the Hindi language as part of the National Education Policy (NEP) from July 2022.

State medical education minister Vishvas Sarang, the driving force behind the move, said Madhya Pradesh is the first state in the country to come out with the initiative to teach MBBS in Hindi.

We are starting MBBS course in Hindi for the first time in the country. No other state is offering medical education in the mother-tongue Madhya Pradesh is the first to do so, he told PTI.

Sarang said textbooks, especially in physiology, anatomy and biochemistry, are being prepared in Hindi for students and they will be made available soon.

However, experts in the medical fraternity remain sceptical about the MBBS in Hindi move.

Former vice-chancellor of Indore-based Devi Ahilyabai Vishwa Vidyalaya (DAVV) and a senior pediatrician, Dr Bharat Chhaperwal, said, I am not against imparting medical education in Hindi, but are quality textbooks with updated advancements in the field available for students?

Research articles published in quality medical journals like Lancet, British Medical Journal and New England Medical Journal, among others, take three to four years at least to find a place in textbooks, he said.

Chhaperwal said he is not against Hindi, but as a medical professional he feels not enough preparations were made before announcing the decision.

Governments should leave this issue to professionals instead of deciding in which language medicine and surgery should be taught, he said.

When pointed out that in many countries like Japan, Russia, China and France, medical education is being imparted in the mother tongue, Chhaperwal said in these nations an adequate number of quality textbooks are available in their native language, which was not the case in India.

The government has created a Hindi university in the state and tasked it with preparing MBBS textbooks in the widely spoken language, but this will not benefit pupils as such, especially tribals, he said.

If the government really wanted to transform the lives of tribals then it should start giving them quality education right from the beginning, the former vice- chancellor remarked.

A senior Bhopal-based doctor, Pushpendra Sharma, who has done his MBBS and a course equivalent to MS Surgery from the Odessa State Medical University in Ukraine, said a lot of efforts will be required to make the move successful.

It is not such a simple task to start teaching MBBS in Hindi. The move requires a lot of preparations as medical terminologies need to be translated in Hindi first. It is a tough call, he remarked.

Asked how some other countries are managing to impart medical education in their native language, Sharma said they had been doing so for ages and therefore have developed a rich course content for students.

A former director of the All-India Institute of Medical Sciences (AIIMS), speaking on the condition of anonymity, termed the decision as unfortunate , but did not elaborate.

However, senior BJP leader and a doctor by profession, Dr Hitesh Bajpai, supported the move.

We are committed to provide technical education in the mother tongue of students. One should not be left behind because of any language, he said.

Minister Sarang said textbooks for three subjects to be taught in the first year are being readied by a team of experts.

Books are being prepared in such a manner that technical terms like blood pressure, spine, heart, kidney, liver or other important body parts and related terms are written in Hindi, Sarang said.

We are preparing textbooks in such a manner that those studying MBBS in Hindi will not lag behind after completion of the course as they will be learning all the technical and medical terms in English as well in Hindi, he added.

Sarang said in the first year only three subjects physiology, anatomy and biochemistry are mainly taught to students.

Our preparations are on for making the textbooks available in Hindi for students before the start of the course, the minister said.

View post:
Teaching MBBS in Hindi is a good idea, but where are quality textbooks? ask experts - The Siasat Daily

It is with profound sadness that we inform you about the passing of a beloved member of our Duke Anesthesiology family, Peter Bennett, PhD, DSc, emeritus professor of anesthesiology. He passed away on August 9 at the age of 91. Dr. Bennett will be remembered as a highly respected researcher and entrepreneur who dedicated his life's work to the advancement of diving. A champion of dive safety, he notably founded the Divers Alert Network (DAN) in 1980 - a non-profit organization, which he led for 23 years. DAN is the worlds most recognized and respected dive safety organization that helps divers in need of medical emergency assistance and promotes dive safety through research, education, products, and services.

Dr. Bennett was born in England, where he earned his doctorate and doctor of sciences in physiology and biochemistry at the University of Southampton. He began his career as a scientist investigating the physiology of deep diving, particularly the mechanisms of high-pressure nervous syndrome. In 1972, Dr. Bennett moved to the United States and joined Duke Anesthesiology where he was appointed director of research in the department and co-director of Dukes FG Hall Environmental Laboratory. Dr. Bennett went on to become director of the lab in which he led a team of investigators during performance of a series of human deep dives in the Hall Labs hyperbaric chambers to a world record depth of 2,250 feet of sea water. After retiring as president of DAN in 2003, Dr. Bennett became the executive director for the Underwater Hyperbaric Medical Society until 2014. As a leading authority on the effects of high pressure on human physiology, he published more than 100 scientific papers and nine books, including the signature textbook, Physiology and Medicine of Diving, known as a definitive work in his field. He was also a mentor to many junior scientists around the world.

Dr. Bennett leaves behind his wife, Margaret, and son, Chris. Please join us in extending our sincerest condolences to Dr. Bennett's family, friends and colleagues. Duke flags will be lowered in honor of his life and legacy.

Link:
In Remembrance of Dr. Peter Bennett | Duke Department of Anesthesiology - Duke University

Prostate-specific membrane antigen, or PSMA, has made headlines in the past several years with several important clinical trials demonstrating both diagnostic and therapeutic benefits. PSMA, a transmembrane glycoprotein, is frequently overexpressed in the prostate cancer epithelium, allowing it to serve as a target lesion for biomarkers for diagnostic or therapeutic purposes.1 Examples of therapeutic compounds include lutetium-177-PSMA-617 (177Lu-PSMA-617), which was reported on earlier in 2021 for its role in the treatment of patients with metastatic castration-resistant prostate cancer.

To review, when a biomarkerfor diagnostic or therapeutic purposesbinds to the PSMA receptor, it triggers an endocytotic process that facilitates development of higher concentrations of the bound biomarkers inside the prostate cancer cells.2 On the diagnostic side, there are generally 2 classes of PSMA-based biomarkers that have been widely adopted into use: gallium-68 (68Ga)-PSMA-11 (also known as gozetotide) and fluorine-18 (18F)-based PSMA compounds.

The clinical impact of PSMA-based imaging has been documented by several studies, including a meta-analysis demonstrating that attaining a PSMA-based imaging studyespecially in patients with suspected biochemical recurrence after primary therapycan often lead to a change in the management approach. In a meta-analysis of 1,309 patients, Perera et al demonstrated that 68Ga-PSMA-11 scans had a 76% positivity rate for biochemical recurrence and led to a change in management 54% of the time.3 Despite many positive reports showing promising uses of 68Ga-PSMA-11, geographic availability remains a primary limitation because of its short 68-minute half-life, which restricts its ability to become commercially available and therapeutically viable in parts of the country where access is an issue.4

The primary alternative to 68Ga-PSMA-11 using the PSMA biomarker is the 18F class of compounds, which has slowly gained wide recognition. The CONDOR trial investigated the use of 18F-DCFPy (Pylarify; piflufolastat positron emission tomography/computed tomography [PET/CT]) in patients thought to have biochemical recurrence after primary therapy (prostatectomy or radiation).5 Of the 208 patients enrolled in the trial, the authors reported a 63.9% change in management after Pylarify imaging, which is in line with the data in published reports of 68Ga-PSMA-11.5

At the 2022 American Urological Association Conference (AUA 2022), results of the phase 3 SPOTLIGHT study were presented that demonstrated the efficacy of 18F-rhPSMA-7.3 for diagnostic imaging in patients with prior localized therapy for prostate cancer who have concern about biochemical recurrence. The rhPSMA class is a subclass of PSMA compounds that allows for faster radiolabeling and decreased urinary clearance compared with 68Ga-PSMA-11.6,7 The latter point has been thought to be a significant impairment to image interpretation owing to the blurring of images produced by concentration of the compound within the urinary bladder.

Several other 18F-based PSMA ligands have been developed, including 18F-DCFPyL and 18F-rhPSMA-7. Proposed benefits of the 18F class of biomarkers, compared with 68Ga-PSMA-11, include its longer half-life (120 minutes), which facilitates simplified transport protocols, and therefore greater patient access, and makes higher quantities of production in cyclotrons (particle accelerators that produce radioactive isotopes) possible.6 Furthermore, 18F-based imaging is also thought to provide greater spatial resolution, leading to fewer blurring artifacts on the final imaging studies.

The SPOTLIGHT study (NCT04186845),8 which was reported at AUA 2022 and covered in a previous issue of GU Oncology Now, sought to explore the utility of 18F-rhPSMA-7.3 in the biochemical recurrence setting by identifying patients with increasing prostate-specific antigen (PSA) levels after primary treatment. All patients enrolled in SPOTLIGHT had negative results on conventional imaging, and all images were interpreted by 3 separate radiologists. The exploratory analysis demonstrated that obtaining 18F-rhPSMA-7.3 imaging at the time of concern for biochemical recurrence led to a 45% to 47% rate of upstaging. An interesting fact of note was that patients undergoing primary radiotherapy had higher rates of positivity in the prostate bed compared with those who underwent prostatectomy although their pelvic lymph nodes and extrapelvic regions were similar.

In a recent issue of European Urology, the authors of a double-blind phase 3 randomized controlled trial compared 68Ga-PSMA-11 with 18F-PSMA-11.9 In their introduction, they explain many of the limitations of 68Ga, including its short half-life and the cost of generating the compound. The trial, conducted out of Ghent University Hospital, Belgium, enrolled patients thought to have biochemical recurrence after primary therapy or prostate cancer confirmed by biopsy. Patients with limited renal function (serum creatinine >2 or estimated glomerular filtration rate <30) were excluded.

By design, all patients underwent both 18F-PSMA-11 and 68Ga-PSMA-11 scans. The primary endpoint was noninferiority of 18F-PSMA-11 compared with 68Ga-PSMA-11. The authors also investigated several secondary endpoints, including the number of positive PET scans, lesions suspicious for prostate cancer, and correlation of PET imaging with follow-up data. The trial had significantly more patients with concern for biochemical recurrence (n=66) compared to primary prostate cancer (n=19); however, other characteristics, including median age, were similar between the 2 groups.

In regard to the primary endpoint, the 2 imaging modalities had the same positivity rate (67%; 55 of 82 patients with positive scans). Secondary endpoints demonstrated no superiority of 18F- over 68Ga-based imaging, but the authors did note that 18F-PSMA-11 scans had a higher rate of equivocal lesions in the axial skeleton. Specifically, they noted that 18F-PSMA-11 scans demonstrated additional lesions in skeletal tissue in 9 patients and in lymph nodes in 4 patients. They attributed this to a known downside of 18F radioisotopes but explained that this hypersensitivity may be useful in detecting small positive lesions in patients with very low PSA values in whom clinicians might have concern for recurrence. The authors noted in their conclusion that this was the largest prospective phase 3 trial comparing 18F-PSMA-11 and 68Ga-PSMA-11 and suggested that 18F-PSMA-11 is a cost-effective alternative to 68Ga-PSMA-11 that achieves similar results.

Other ongoing clinical trials in progress will help elucidate the role of 18F-PSMA-11 in the management of prostate cancer. One trial of interest is an investigation into the role of 18F-PSMA scans in the primary localized treatment setting (NCT04461509). Another is a phase 2 trial being conducted at the University of Alberta, which is exploring the role of 18F-PSMA imaging in locoregional staging of patients undergoing radical prostatectomy for clinically significant prostate cancer (NCT05141760). These investigations and others will continue to provide valuable insights into the role and utility of PSMA-targeted imaging in the treatment of patients with prostate cancer.

References

Excerpt from:
Introduction to 18F-PSMA: An Alternative Radioisotope for PSMA-based Imaging - DocWire News