Purdue biochemistry professor Clint Chapple named to National Academy of Sciences – Purdue University

WEST LAFAYETTE, Ind. Clint Chapple, distinguished professor in the Purdue University College of Agricultures Department of Biochemistry, has been elected to the National Academy of Sciences. NAS membership recognizes achievement in original research and is widely regarded as one of the highest honors in science and technology.

Chapple will be among approximately 2,400 active U.S. NAS members. Academy members elect a maximum of 120 U.S. researchers and 30 international members annually for outstanding professional achievement and commitment to service.

Election into the NAS is an outstanding honor for scientists, and Clint is most deserving, said Karen Plaut, the Glenn W. Sample Dean, College of Agriculture. He is a top-notch scholar who has received awards for research, teaching and mentoring students. We are elated he has been recognized for his contributions to his field, and we are proud to have him as part of our faculty.

Andrew Mesecar, head of the Department of Biochemistry, said, He was elected to the National Academy because of his forefront contributions to his field. He is world renowned for that and for his service to the plant sciences community. This is what the world sees. What the world doesnt see is an exceptional leader who is willing to sacrifice for the greater good of the department.

The NAS specifically noted Chapples work in understanding the biosynthesis of lignin, the hardening component in plant cell walls that serves various important biological functions. In Chapples nearly 30 years at Purdue, his study of lignin has expanded along with its applicability to pulp and paper production, animal feedstocks and biofuels.

The plant cell wall is a fundamental part of the plant body, Chapple explained. Starting in 1993, my group was able to learn about the fundamentals of what enzymes and genes are important for plants to make lignin in the cell wall. We were able to manipulate their expression and learned to reprogram the plant to make a lignin that might be more suitable for a variety of applications. Overall, we learned a lot in the process.

Plaut noted that Chapple also has been instrumental in advancing plant sciences initiatives that have strengthened research and teaching in the College of Agriculture. Chapple co-founded and directed the Center for Plant Biology, which hired 10 new assistant professors to work across multiple disciplines within the center, funded as part of the Institute of Plant Sciences.

Investment in plant sciences through Purdue Moves and its successor, Purdues Next Moves, has helped sustain an environment in which Chapples research has flourished. He credits his former and current graduate students and postdocs for their contributions:

Ive had great people in my lab, many of whom are in industry or faculty members at other universities, he said.

Chapple values his NAS election as affirmation from highly accomplished peers.

If you can move the needle in terms of human knowledge and get paid for it and have fun! thats a great opportunity, he said. Ive been very fortunate.

Media contact: Maureen Manier, mmanier@purdue,.edu

Source: Clint Chapple, chapple@purdue.edu

Agricultural Communications: 765-494-8415;

Maureen Manier, Department Head, mmanier@purdue.edu

Agriculture News Page

See original here:
Purdue biochemistry professor Clint Chapple named to National Academy of Sciences - Purdue University

Calcium Citrate Market Insights 2021 to 2028, Research By Key Players Jungbunzlauer, Gadot Biochemical Industries, Sucroal, Saminchem Inc, Jost…

Calcium Citrate MarketResearch Report is a Professional and In-Depth Study on the Existing State of Calcium Citrate Industry. This report focuses on the Major Drivers, Restraints, Opportunities, and Threats for Key Players likeJungbunzlauer, Gadot Biochemical Industries, Sucroal, Saminchem Inc, Jost Chemical, RZBC GROUP, etc. It also Provides Granular Analysis of Market Share, Segmentation, Revenue Forecasts, and Regional Analysis till 2028.

Further, the Calcium Citrate Market report also covers the development policies and plans, manufacturing processes and cost structures, marketing strategies followed by top players, distributors analysis, marketing channels, potential buyers, and Calcium Citrate development history. This report also states import/export, supply, and consumption figures as well as cost, price, revenue and gross margin by region.

Request for Sample Copy of Calcium Citrate Market with Complete TOC and Figures & Graphs @https://opulencemarketresearch.com/industry-analysis/sample/23934

The Calcium Citrate market report covers major market players like

Calcium Citrate Market is segmented as below:

By Product Type:

Breakup by Application:

Get a Discount on Calcium Citrate Market Report @https://opulencemarketresearch.com/industry-analysis/discount/23934

Along with Calcium Citrate Market research analysis, buyer also gets valuable information about global Calcium Citrate Production and its market share, Revenue, Price and Gross Margin, Supply, Consumption, Export, Import volume, and values for the following Regions:

Impact of COVID-19 on Calcium Citrate Market

The report also contains the effect of the ongoing worldwide pandemic, i.e., COVID-19, on the Calcium Citrate Market and what the future holds for it. It offers an analysis of the impacts of the epidemic on the international market. The epidemic has immediately interrupted the requirement and supply series. The Calcium Citrate Market report also assesses the economic effect on firms and monetary markets. Futuristic Reports has accumulated advice from several delegates of this business and has engaged from the secondary and primary research to extend the customers with strategies and data to combat industry struggles throughout and after the COVID-19 pandemic.

For More Details on the Impact of COVID-19 on Calcium Citrate Market @https://opulencemarketresearch.com/industry-analysis/covid-19/23934

Calcium Citrate Market Report Provides Comprehensive Analysis as Following:

For more Information on Calcium Citrate Market Research:https://opulencemarketresearch.com/industry-analysis/buying/23934

Frequently Asked Questions

AboutOpulence Market Reports:

Opulence Market Research is the next generation of all your research needs with a strong grapple on the worldwide market for industries, organizations, and governments. Our aim is to deliver exemplary reports that meet the definite needs of clients, which offers an adequate business technique, planning, and competitive landscape for new and existing industries that will develop your business needs.

We provide a premium in-depth statistical approach, a 360-degree market view that includes detailed segmentation, key trends, strategic recommendations, growth figures, Cost Analysis, new progress, evolving technologies, and forecasts by authentic agencies.

For More Details Contact Us:

Opulence Market Reports

Phone Number:+1 (424) 256-1722

Email:[emailprotected]

Website:https://opulencemarketresearch.com/

See the rest here:
Calcium Citrate Market Insights 2021 to 2028, Research By Key Players Jungbunzlauer, Gadot Biochemical Industries, Sucroal, Saminchem Inc, Jost...

Haley Jostes ’23 Named Goldwater Scholar – The junior chemistry and biochemistry and molecular biology double major plans to pursue graduate research…

Haley Jostes '23

Haley Jostes 23, a Gustavus Adolphus College junior with majors in chemistry and biochemistry and molecular biology, has been named a Goldwater Scholar in recognition of her exceptional research contributions and future promise.

Established by Congress in 1986, the Goldwater Scholarship Program is one of the oldest and most prestigious national scholarships in the natural sciences, engineering, and mathematics in the United States. Higher education institutions can nominate up to four sophomore and junior students, and the selected scholars receive up to $7,500 each academic year in support of their research endeavors.

Haley Jostes 23

Jostes is one of the 417 scholars selected from over a thousand nominees across the country. The Goldwater Scholarship is something you can mention in the scientific research world and pretty much everyone knows what it is, she said. Its a really great springboard into future research positions.

The Goldwater Scholarship isnt the first fellowship shes earned as a Gustavus researcher. In 2021, she was awarded a DAAD RISE Scholarship to complete a summer research internship at TU-Bergakademie Freiberg in Germany. Her research focused on PFAS, colloquially known as forever chemicals due to their inability to break down in nature, and how clay nanodeposits could be used to absorb and remove PFAS from water.

Jostess work took place in a large international laboratory, with collaborators from Spain, the United Kingdom, and the United States.It was a noticeable change from the labs at Gustavus, where Jostes worked closely with environmental studies and chemistry professor Jeff Jeremiason and chemistry professor Dwight Stoll.

Both professors have been instrumental in helping me build my career and research path, said Jostes. Theyre very different in their mentorship style, but both have your best interests at heart.

Jostes found additional mentorship at Gustavus through the older students in her labs who introduced her to various undergraduate research scholarships. Their advice led her to the Fellowships Office, where she received valuable guidance on her applications and cover letters. The whole application process forced me to look at exactly what I want to do with my future, said Jostes. What do you want to do and why? How are you shaping your path right now? That self-examination was really helpful.

Jostes is considering several paths to continue research after Gustavus, including graduate studies in analytical and water chemistry and a year-long Research Experience for Undergraduates (REU) through the National Science Foundation.

For Jostes, seeking out new research opportunities is continuing a passion shes developed since high school, where she participated in regional, national and international science competitions. During her college search, she passed up large research institutions in favor of Gustavus, which promised a high-quality undergraduate research program in a small, personable environment that would expose her to subjects beyond her major.

I have a minor in statistics, and Im finishing up a minor in management. I dont think thats something I would have done if I wasnt at a liberal arts college.

Now, she encourages first-year Gusties to take advantage of the First-Year Research Experience (FYRE) Program and other opportunities to get involved with the kind of work that fuels her curiosity about the mysteries of our world.

The thing I love most about research is that there are unanswered questions, she said. The answers already exist for a homework sheet, but doing research lets you look into a realm of things that are unexplored.

Students interested in applying for a fellowship are encouraged to fill out the Fellowship Offices first meeting form to schedule an appointment. For more information about the Gustavus Fellowships Office and the support it gives to students, please visit the fellowships website.

###

Media Contact: Director of Media Relations and Internal Communication JJ Akinjakin@gustavus.edu507-933-7510

More here:
Haley Jostes '23 Named Goldwater Scholar - The junior chemistry and biochemistry and molecular biology double major plans to pursue graduate research...

Chance to mix engineering, biochemistry with golf leads Union Grove’s Norah Roberts to join Wisconsin contingent at North Dakota State -…

Like most high school golfers in search of a college home, Norah Roberts had established a specific list of criteria and applied it to each school she visited.

"My biggest piece of advice would be to do your research and really figure out what you want. Knowing what you are looking for in a school and golf program is the most important thing for any athlete to be aware of.

"From there, you really need to put yourself out there. College coaches arent necessarily going to find you; instead, you need to find them and let them know youre there. If you arent willing to take the time to send a lot of emails and keep updating coaches on your recent results, it is going to become a lot more difficult for you to find the right fit.

"After awhile, you will have to decide what schools to focus in on based on what schools have shown an interest. From my experience you can send 20 emails to some coaches and never receive a response from them. When this happens, it is important to realize that there are other schools out there. ... It is key that you dont confine yourself to a small list of prospects. Allowing this will likely lead to disappointment.

"Finally, I would like to say that I would love to answer any questions that an athlete may have as they are going through their own recruiting process, since I know it can be a confusing and frustrating process."

Specifically, the Union Grove senior and No. 1 golfer in the Wisconsin.Golf girls Class of 2023 state rankings and 2021 WIAA Division 1 state runner-up wanted a school that offered:

A college-town feel.

A good-sized student population.

A solid women's golf program.

A broad choice of majors from which to choose.

"North Dakota State checked all of the boxes, which led to my commitment," Roberts wrote in an email interview with Wisconsin.Golf, elaborating on her March 26 tweet announcing her decision to choose the Bison over UW-Green Bay, Butler, Loyola (Ill.), Drake, Missouri State, Creighton, Indiana University-Purdue University-Indianapolis and Bradley, "to mention a few" of the schools that she was considering and/or visited during the recruiting process.

"Most of the schools I visited had golf programs that felt like a family, but what made NDSU stand out is that it gives me a lot of academic freedom. It was the only school that offered both majors that I am interested in: engineering and biochemistry. Not to mention that NDSU has a good golf program and features a solid, competitive schedule in both the fall and spring seasons."

Roberts' decision continues the export of talent from the Wisconsin PGA Junior Tour to coach Matt Johnson's NDSU program in Fargo.

Over the last 12 months, both Middleton's Alexis Thomas and Oregon's Taylor McCorkle completed their college careers with the Bison. Currently, sophomore Holly Murphy of Lake Geneva and freshmen Jo Baranczyk of Green Bay and Elise Hoven of Grafton are on the NDSU roster, with Baranczyk (second in scoring during the 2021-22 season at 77.21) and Hoven (fourth at 77.40) having found homes in the Bison lineup.

"I went on a campus visit in February and I was able to meet and hang out for a few days with the team," Roberts wrote. "We attended a basketball game, which gave me a good feel for the amount of school spirit that both the school and the city of Fargo have for their university. I visited their facilities and was able to practice with them twice.

"They have a really nice short-game center, Trackman simulator and are currently building a new indoor sports center. Additionally, Coach Johnson was very receptive and easy to communicate with during this whole process."

In Roberts, the Bison are getting a golfer who has enjoyed steady improvement since reaching high school.

After winning five events on the WPGA Junior Tour and three more on the Tour Edge Milwaukee County Parks series in 2019 and 2020, Roberts broke through in 2021 with her first major championship victory at the Wisconsin Junior Girls State Championship, added T-2 finishes at the Lake Arrowhead Invitational and WIAA state tournament and a pair of of third-place showings at the Morgan Stanley Tour Championship and the Sherri Steinhauer. She also turned heads with solid showings at the Wisconsin State Women's Amateur (T-10) and the Wisconsin State Women's Open (T-28).

"I hope to go there and be able to contribute to the team as well as learn things from the players that are more experienced playing at the college level," Roberts wrote. "NDSU has had and currently has some great players. They have won tournaments and conference championships in the past and that is still their goal moving forward. I want to be part of that tradition and work to make those goals a reality."

Original post:
Chance to mix engineering, biochemistry with golf leads Union Grove's Norah Roberts to join Wisconsin contingent at North Dakota State -...

Class of 2022: Ziff Balances Mind and Body With Biochemistry and Dance – UVA Today

Ziff graduated from James Madison High School in Vienna, Virginia, but because her father works for the State Department, the family moved to different countries every few years, she said.

Her experiences of science classes varied from place to place, she said. In Bogot, she and just four peers would get to their 7 a.m. AP biology course, where the instructor encouraged them to be curious and used a Socratic method of inquiry. In Rome, her AP chemistry course was more traditional.

As the family moved around the world, she danced wherever they went.

It was often a way to connect with my peers in different countries, Ziff said. When my family moved to a new place including Venezuela, Italy, Colombia, Spain or the U.S. I would search for a new dance studio and enroll, and it not only continued my practice, but helped me make local friends and learn the language.

After Ziff studied with the Kibbutz Contemporary Dance Company in Northern Israel several times, and then the danza180grados conservatory in Madrid, Spain, she decided that this pursuit of experiences in movement was not just a hobby and she would put more effort into it. The program in Israel was especially demanding and intensive, she said. She returned to the Israeli dance company for five months during a gap year before coming to UVA.

That was a turning point. I knew I wanted to continue studying dance in college, said Ziff, whose mother is Israeli. I wanted to major in biochemistry and minor in dance because Im interested in the details.

She added that she was increasingly interested in the more intricate pathways of life, how tiny fragments of us transform and interact, literally on the molecular level.

She acknowledged that studying chemistry and practicing dance require different kinds of learning, but there are similarities, as well.

There are many small parts that make up the molecular intricacies of the bodys regulation, and changing a few of those parts can have rippling effects, Ziff said. As I learned more about dance, I realized that small changes in body language, style, music choice, lighting and a host of other factors within a piece of choreography can completely shift its mood and meaning.

Despite its small size, UVAs dance program, housed in the Drama Department, offered some mighty strong opportunities for a motivated student like Ziff, who had to get even more creative during the COVID-19 lockdown.

She joined the Miller Arts Scholars, an interdisciplinary arts program that offers a variety of resources for undergraduates to pursue their artistic dreams. The students meet in required seminars, work with faculty and visiting artists, and plan projects and events in their fields. They not only have to present a proposal for a project, but also follow up with a report on the outcome.

For a project last year, Ziff choreographed and created a dance film, learning how to record and edit a performance. In 2020-21, she also earned funding for a Rising Third-Year Arts Award, originally to attend an intensive training session at the American Dance Festival in New York City. When the pandemic prevented that, she and fellow student Kiana Pilson, another Miller Arts Scholar in Dance and arts awardee, commissioned an original duet from acclaimed choreographer Helen Simoneau, to be performed at the UVA Dance Programs Virtual Spring Dance Concert. They produced the piece as a dance film.

See more here:
Class of 2022: Ziff Balances Mind and Body With Biochemistry and Dance - UVA Today

The companion animal diagnostics market is projected to reach USD 3.8 Billion by 2027 from USD 2.4 Billion in 2022 at a CAGR of 9.6% – Yahoo Finance

ReportLinker

during the forecast period. The growth in this market is mainly attributed to the increasing companion animal population, rising demand for pet insurance, growing animal health expenditure, and the increasing number of veterinary practitioners & their rising income level in developed countries.

New York, May 09, 2022 (GLOBE NEWSWIRE) -- Reportlinker.com announces the release of the report "Companion Animal Diagnostics Market by Technology, Application, Animal, End User - Global Forecast to 2027" - https://www.reportlinker.com/p05773304/?utm_source=GNW However, increasing pet care costs are expected to hinder market growth to a certain extent.

Clinical Biochemistry segment holds largest share in the companion animal diagnostics market in 2021The companion animal diagnostics market is segmented into clinical biochemistry, immunodiagnostics, hematology, urinalysis, molecular diagnostics, and other companion animal diagnostic technologies on the basis of technologies.The clinical biochemistry segment holds the largest share of the companion animal diagnostics market in 2021.

Clinical biochemistry is an important technology used for screening infectious and metabolic disorders in small animals. The clinical biochemistry market is segmented into clinical chemistry analysis, glucose monitoring, and blood gas electrolyte analysis.

Clinical Pathology segment is expected to grow at the fastest growth rate during 2022-2027The companion animal diagnostics market is segmented into clinical pathology, bacteriology, virology, parasitology, and other applications based on application type.In 2021, clinical pathology was the largest application segment in this market owing to the high volume of clinical pathology tests performed on companion animals.

Clinical pathology encompasses hematology, clinical chemistry, cytopathology, endocrinology, urinalysis, coagulation, immunohematology, and general pathology. In the case of chronic diseases, veterinarians recommend routine blood and urine check-ups, wherein pathologists work alongside vets in order to evaluate the true causes of diseases.

The diagnostics laboratories holds the largest share of companion animal diagnostics market in 2021The companion animal diagnostics market is segmented into diagnostic laboratories, veterinary hospitals & clinics, research institutes & universities,and home care settings based on the end user type.The diagnostic laboratories segment holds the largest share of of this market in 2021.

The large share of this segment can be attributed to a large number of samples received for analysis in these laboratories from small and large animal practices. Rising awareness among pet owners regarding routine and preventive care is further expected to propel market growth.

North America accounted for the largest share of the companion animal diagnostics market in 2021The companion animal diagnostics market is segmented into North America, Europe, Asia Pacific, Latin America, the Middle East, and Africa based on the region type.North America holds largest share of of the companion animal diagnostics market in 2021.

The large share of this segment can be attributed to the increasing animal population, growing pet insurance, and rising animal health expenditure in North America.The Asia Pacific region is projected to grow at a CAGR of during the forecast period.

Factors such as the rapidly increasing animal population, growing awareness about animal welfare, and the rising prevalence of zoonotic diseases are driving the growth of this regional market.A breakdown of the primary participants (supply-side) for the companion animal diagnostics market referred to for this report is provided below: By Company Type: Tier 160%, Tier 230%, and Tier 310% By Designation: C-level30%, Director Level50%, and Others20% By Region: North America45%, Europe15%, Asia Pacific23%, Latin America- 10%, and Middle East and Africa 5%Key players in this market are adopting several organic and inorganic growth strategies (such as product launches, agreements, collaborations, acquisitions, and expansions). Some major players in this market are Idexx Laboratories, INC. (US), Zoetis, INC. (US), Heska Corporation (US), Thermo Fisher Scientific, INC. (US), Biomrieux SA (France), Virbac (France), Neogen Corporation (US), Fujifilm Holdings Corporation (Japan), Indical Bioscience GmbH (Germany), Idvet (France), Randox Laboratories, LTD. (UK), Shenzhen Mindray Animal Medical Technology Co., Ltd. (China), and BioNote, Inc (South Korea).

Research Coverage:The market study covers the companion animal diagnostics market across various segments.It aims at estimating the market size and the growth potential of this market across different segments by Technology, Application, Animal, end user, and region.

The study also includes an in-depth competitive analysis of the key players in the market, along with their company profiles, key observations related to their product and business offerings, recent developments, and key market strategies.

Key Benefits of Buying the Report:The report will help market leaders/new entrants in this market and provide information regarding the closest approximations of the companion animal diagnostics market and its segments.This report will help stakeholders understand the competitive landscape, gain insights to position their businesses better, and plan suitable go-to-market strategies.

The report will also help stakeholders in understanding the pulse of the market and gaining information on key market drivers, restraints, opportunities, and challenges.Read the full report: https://www.reportlinker.com/p05773304/?utm_source=GNW

About ReportlinkerReportLinker is an award-winning market research solution. Reportlinker finds and organizes the latest industry data so you get all the market research you need - instantly, in one place.

__________________________

Story continues

View original post here:
The companion animal diagnostics market is projected to reach USD 3.8 Billion by 2027 from USD 2.4 Billion in 2022 at a CAGR of 9.6% - Yahoo Finance

Outstanding Seniors in the College of Science: Kiah Sleiman – University of Arizona News

This spring, each department in the University of Arizona's College of Science nominated an outstanding senior who went above and beyond during their time as a Wildcat. We are pleased to share their stories as they reflect on their time at UArizona. Next up in the senior spotlight series is Kiah Sleiman.

Hometown: Tucson, AZ

Department:Chemistry & Biochemistry

College of Science: Why did you choose your area of study?

Kiah: In my life, I have always been encouraged to understand the why whenever I learned something new, which allowed my curiosity to flourish. My job leading into my college years was a lifeguard at a therapeutic facility, where I interacted with elderly people with many different ailments that did not have direct treatments, like rheumatoid arthritis. The treatments for RA target mostly the symptoms rather than the root of the disease, and in my curiosity of why autoimmunity is more severe in some individuals than others, I joined an RA research lab my senior year of high school. Inspired with what I learned working there, I had decided that I wanted to do biomedical research, and biochemistry is the perfect area of study to provide the base knowledge required to branch into many more nuanced fields, like immunology. With biochemistry, I established a foundation for myself that I would be able to build on in whatever specific field of research that I decide to pursue, while not limiting myself when first starting college.

COS: Tell us about a class or research project you really enjoyed.

Kiah:Having worked in an immunology lab throughout college, I finally had a chance to take an immunology class my Fall semester senior year with Dr. Wilbur. Being able to go back to basics and build an understanding of the immune system as a whole, rather than immediately focusing on the narrow portion that I had been studying in lab, gave me a new appreciation for what I had been observing and opened up new avenues and questions to pursue. After that class, it really felt like everything clicked into place in my experiences of the previous years. Dr. Wilburs Art Show elevated the whole class to another level, when, after having delved into a complex topic like immunology all semester, you have to then step back and think creatively about how to simplify the topic enough to become approachable to someone outside the field.

COS: What is one specific memory from your time at UA that you'll cherish forever?

Kiah:Before COVID hit my sophomore year, I had just begun the process of expanding my focuses beyond academics and trying to be social. Post-COVID, developing a strong social life seemed impossible, but the friendships I had formed pre-COVID actually solidified during quarantine. Between FaceTime and Zoom, we were able to have study sessions and still have fun while being socially distanced. Before quarantine, one friend and I would cook together every Saturday, trying new recipes and experimenting with weird fruits. At one point during the lockdown, we decided to try to do that again virtually and find something we both could make with what we had in our kitchens. After a long rabbit hole of bizarre adaptations of recipes from the Great Depression, we eventually landed on making tortillas from scratch. While it wasnt a complex recipe, the return to some level of normalcy along with the chaos of trying to make tortillas over FaceTime together filled me with hope, and I will take that experience with me forever. I had never been so excited to have a tortilla as I was in that moment, and even today we still reference the hilarity of effectively hosting cooking shows for a 3 ingredient, very simple recipe.

COS: What is next for you after graduation?

Kiah:After graduation, I will be continuing my education in pursuit of a PhD in Biology from Baylor University.

See the original post:
Outstanding Seniors in the College of Science: Kiah Sleiman - University of Arizona News

Spartan Showcase: Helena Lin The Daily – The Daily | Case Western Reserve University

Major: Psychology and BiochemistryYear: Third year

With her sights set on veterinary school, Helena Lin intended to major in biology or biochemistry when she first began her studies at Case Western Reserve University.

She gradually realized that becoming a vet was just a childhood dream that originated from her love for her cousins miniature schnauzerand she didnt know much about what its really like to work in the field.

Lin didnt have to dig deep to find her true passion, thoughit was always in front of her.

I found myself interested in every psychology course, and looking back, I realized that I have had the thought of becoming a counselor several times in the past, Lin explained. When I saw my friends struggling with depression symptoms, I really wished that I could have the ability to help them get better, and I still do.

Now a third-year psychology and biochemistry major, Lin believes her undiagnosed social anxiety kept her from thinking about the possibility of becoming a counselor. Her symptoms became more intense over the years, to the point where she couldnt make new friends, didnt ask questions in class, and couldnt muster up the courage to get involved in clubsall things she wished she could do.

It wasnt until her sophomore year at CWRU, when she applied to be an orientation leader, that she realized how much social anxiety was impacting her life.

I was really nervous and my heart was pounding so fast every time I wanted to speak up during the group interview process, said Lin, who traveled to the United States from China to attend Case Western Reserve. I ended up feeling exhausted halfway through the interview and gave up participating and sharing thoughts during some of the portions.

She wasnt selected as an orientation leader. At first she was upset and disappointed with herself, but came to realize that blaming herself wouldnt help her get closer to her goals, and instead, she needed to take steps to overcome her anxiety.

Lin reached out to University Health and Counseling Services to begin her journey, and slowly started to come out of her shellshe started asking the Starbucks barista for a straw when she needed one, and she signed up for English tutoring to improve her language skills.

With encouragement from professors, my friends and family along the way, Im now a peer tutor and I got selected to become an orientation leader for this summer! she said proudly. I think overcoming my social anxiety really helped me get where I am today. I cant say that Ive completely overcome it, but I wont allow it to control me and keep me from reaching my goals any more.

Now, shes compiled a laundry list of achievements at Case Western Reserveand beyond. She volunteered at the Animal Protection League for a while, in addition to completing community service through the Civic Engagement Scholars program. She works as a peer tutor, tutoring students in general chemistry, physiological psychology and biochemistry courses.

Lin has also participated in diversity and inclusion events, and volunteered for the Send Silence Packing event, which aims to end the silence that surrounds mental health while advancing suicide prevention. Lin is also the outreach chair of the Chinese Student Association and a member of Klover, a student K-pop dance group.

When she completes her undergraduate studies, Lin hopes to attend graduate school to prepare to become a counselor or clinical psychologist to help those with mental health conditions.

Though there are many uncertainties in the future, I [hope] I can go back to [work in] China, where mental health awareness and knowledge still needs improvement, she noted.

Read more from the original source:
Spartan Showcase: Helena Lin The Daily - The Daily | Case Western Reserve University

Rochester students win national awards and fellowships – University of Rochester

May 9, 2022

Each year, students and alumni from the University of Rochester earn merit-based external awards in recognition of their achievements in the classroom and research endeavors, as well as their community contributions through leadership and service activities.

The 202122 academic year saw Rochesters second Rhodes Scholarship recipient in as many years, while two students earned Schwarzman Scholarships to study in China. Theyre joined by fellow students and alumni working to make the world ever better through their teaching, research, and community-building efforts across the globe.

More than 200 University students and recent graduates applied for a wide range of national and international fellowship competitions. Nearly three dozen were selected to receive awards.

Applying for a competitive fellowship is already a significant undertaking, but when you add the ongoing challenges, uncertainties, and anxieties related to the global pandemic, all the applicants deserve to be applauded, says Belinda Redden, director of the Students Fellowships Office.

While there are often many people in different roles behind each fellowship applicant, the achievements belong to the applicants themselves. Our office is honored and proud to support such outstanding, ambitious Rochester students and alumni in competing for prestigious awards that help advance them toward theirMelioraaspirations, adds Redden.

The State Department-sponsoredFulbright US Student Programaims to promote mutual understanding and peace between the United States and other nations through educational and cultural exchange. Students and college graduates apply for grants to study, conduct research, or teach English conversation and US culture abroad while serving as citizen diplomats in the host country.

Coralee Everett 22 (molecular genetics)The Bridgeport, New York, resident will head to Spain for an English Teaching Assistantship. Everett aspires to be a pediatrician, specializing in children with intellectual and developmental disabilities.

Peri Goldberg 22 (biology)Goldberg, who is from Ithaca, New York, will investigate the process of bacterial colonization and the resulting host immune response in the gut at the University of Berns Institute for Infectious Diseases in Bern, Switzerland. Shell also participate in journal clubs and seminars to broaden her microbiology knowledge before pursuing a PhD in microbiology.

Anna Groesch 22, 22E (applied music: cello, musical arts, German)The St. Louis resident will undertake an English Teaching Assistantship in Germany. She plans a career that involves the teaching of both music and language.

Karlin Li 22 (molecular genetics)The resident of Acton, Massachusetts, will head to South Korea for an English Teaching Assistantship. After her Fulbright experience, she plans to earn a doctorate in public health.

Dylan Matvey 20 (cell and developmental biology)The Pittsburgh native will complete research at Charit Institute for Biochemistry and coursework at Humboldt University, both in Berlin, Germany. Matvey will work on a synthetic biology project to establish a novel metabolic pathway in E. coli to produce a bioplastic precursor, glyoxylate, from CO2 and fomate. Matvey plans to pursue a PhD and research career focused on synthetic biology to combat climate change.

Quinnlyn Murphy 20, 21 (T5) (political science)The resident of Manchester City, Vermont, will begin an English Teaching Assistantship in Germany, where she spent a semester abroad in 2018 (Berlin). Following her year in Germany, she hopes to work for a nonprofit devoted to environmental protection or sustainability before embarking on graduate study.

Anne Rosenow 22 (political science)Rosenow will undertake an English Teaching Assistantship in Changhua, Taiwan. The Williamsport, Pennsylvania, resident hopes to teach elementary school students in Taiwan and volunteer in an urban garden while learning about local farming practices and national food policies. Afterward, she plans to pursue graduate study and a career in public policy focused on sustainability.

Lauren Sigda 22 (brain and cognitive sciences, art history)Sigda, who is from Larchmont, New York, will head to the University of Vienna in Austria to conduct research into the neurological underpinnings of visual aesthetic preference and complete coursework in cognitive psychology and German. Her Fulbright experience will be a precursor to doctoral study in visual cognitive science.

Caroline Stockwell 22 (biomedical engineering)The Westfield, New Jersey, resident will join the Andalusian Center for Microbiology and Regenerative Medicine in Seville, Spain. Shell investigate ways to improve radiation therapy for patients with brain tumorsthrough study of the mechanism of action of a Mesenchymal Stem Cellbased therapy. Afterward, Stockwell will commence her PhD in the division of pharmacoengineering and molecular pharmaceutics at UNCChapel Hill.

TheBenjamin A. Gilman International Scholarship Programenables American undergraduates of limited financial means to participate in international study and internship opportunities, thereby diversifying the pool of students representing the U.S. abroad while advancing their academic and career goals.

Lisadine Cherubin 23Area of study: Health, behavior, and society (BA)Country: United Kingdom

Justin Pimentel 23Area of study: Computer science (BS)Country: Spain

Andre Tulloch 23Area of study: Health, behavior, and society (BA)Country: United Kingdom

Named after the former senator and presidential candidate, theBarry Goldwater Scholarshipis a highly competitive national award for American undergraduate students in science, math and engineering who are committed to pursuing advanced degrees and research-oriented careers in STEM fields.

Ellen Irving 23 (biochemistry and chemistry)The Penfield, New York, native aspires to earn a doctorate in biochemistry and chemical biology and to conduct research at the chemistry-biology interface, with a focus on protein engineering applications in human health, sustainability, or chemical catalysis.

TheDAAD RISEprogram offers undergraduates from North America, Great Britain, and Ireland summer research internships at top German universities and research institutions. RISE Professional offers research internships in Germany to masters and PhD students.

Nathaniel Webber 23 (computer science and philosophy)The Hingham, Massachusetts resident will be placed at the University of Lbecks Institute of Computer Engineering. His project is human-centered swarm behavior.

Maria Aguilera 20 (MS) (chemistry)Aguilera, now a doctoral student in chemistry at Rochester, is from Palmira, Valle del Cauca Department, Colombia. She will be in the RISE Professional Program at BASF SE, a German multinational chemical company with headquarters in Ludwigshafen. Her project involves the screening of adjuvants for delivery optimization of active ingredients.

The National Science Foundation Graduate Research Fellowship Program supports outstanding students who are pursuing research-based masters and doctoral degrees in STEM, STEM education, and social science fields at accredited US institutions.

Katharine Chang (graduate student)Area of study: Psychology (BA)

Jarod Forer 22Area of study: Mechanical engineering (BS)

Molly Griston 22Area of study: Physics (BS)

Amanda Forti (graduate student)Area of study: Chemical engineering (BS)

Renee Niles (graduate student)Area of study: Chemical synthesis (BS)

Claire Wilson (graduate student)Area of study: Environmental engineering (BS)

Caroline Cardinale (graduate student)Area of study: Mechanical engineering (BS)

Michaela Alarie (graduate student)Area of study: Biomedical engineering (BS)

Alexandre Trapp 20Area of study: Computational biology (BS)

Shon Koren (graduate student)Area of study: Neuroscience (BS)

Emily Dudek 19Area of study: Cognitive psychology (BS)

Projects for Peace is a global program that partners with colleges, universities, and other educational institutions to provide grants to young people who design and implement summer projects focused on promoting peace and conflict resolution.

Souleymane Diallo 24 (politics, philosophy, and economics) and Abdoul Rasmane Maiga 25 (computer science)Diallo is from Guinea and Maiga is from Burkina Faso, both in West Africa. Their project aims to promote long-term peace and reconciliation in Guinea, which has experienced numerous political instabilities, violence, and social injustices.

The nonprofit Public Policy and International Affairs Program was created in 1980 to prepare the next generation of diverse policy and foreign affairs leaders. Undergraduates participate in the Junior Summer Institute, a rigorous, seven-week, graduate-level preparation program hosted by six American universities.

Wesley Mawn 23 (environmental studies)A resident of Northbridge, Massachusetts, Mawn will take part in the PPIA summer program at Carnegie Mellon University in Pittsburgh. He plans to attend graduate school and build a career in public service.

The Charles B. Rangel International Affairs Program is a State Department fellowship program that supports outstanding American students from diverse backgrounds in pursuing masters degrees to prepare for diplomatic careers in the US Foreign Service.

Marco Ramos 19 (international relations)The dual US-Mexico citizen has worked as a paralegal for a Washington, DC, law firm since 2020 and will attend Georgetown University on scholarship this fall as part of the Master of Science and Foreign Service program.

Tags: awards, featured-post, quality education

Category: Featured

Here is the original post:
Rochester students win national awards and fellowships - University of Rochester

Meet the 3 who landed in 1st place for Port Neches-Groves’ graduating class – Port Arthur News – The Port Arthur News

PORT NECHES Sai Gelivi, Kaden Allen and Cyrus Bronson have been competing against each other for years so much so, they tied for valedictorian.

And while the final decision was made by a thorough review of every students high school grades, being first in the 2022 Port Neches-Groves High School graduating class remains an honor shared among them.

It started freshman year, Bronson said. I mean I love school, I studied hard, I did my own thing. I think what started it was probably in February they sent us a letter, and I saw first on my paper.

It was a small group of about eight or nine of us, and ever since then it was a competition. Were all still friends. Sophomore year we doubled upnot trying to outdo each other, but outdo each other. It started to dwindle when we started competing more.

And even after the tie was broken, they continued to do so in a friendly way while speaking with Port Arthur Newsmedia.

Personally my hardest class throughout my high school career has been physics, Gelivi said. I think I kept an A-plus in every single class except physics. Its still a good grade, but its just scary. That class challenges me to the extreme.

Allen made the group laugh by following her statement with, Im doing great. I took physics last year. Im just cruising through this year.

From left: Cyrus Bronson will be attending Louisiana State University. Sai Gelivi and Kaden Allen will both be at University of Texas at Austin.

Future plans

Following graduation May 25, Allen and Gelivi will leave for the University of Texas at Austin, while Bronson will be attending Louisiana State University.

All three will be ultimately enter the medical field.

I want to become a doctor and specialize in endocrinology, said Gelivi, who plans to major in biochemistry. I think we could use more of them.

Bronson will also be studying biochemistry, and Allens ultimate goal is to be a neurosurgeon.

Two of the three will be in school together with other peers, but one will be in a new town.

Im excited to go, Bronson said. I dont really have anyone in Baton Rouge. My girlfriend goes to school there, so I know her. Other than that, Im starting out fresh. I dont have any roots over there. So I am happy that it is only 3.5 hours from home. I will definitely be driving home on the weekends sometimes.

However, the senior has gotten a head start on making new friends through social media.

A lot of the time you go on Instagram pages, they have Instagram pages for your school where you can post yourself, people will comment and you can establish a friend group through there, Bronson said. Its just finding people with the same interests. I like to surf, so Ive made a few friends like one who lives in Virginia and loves surfing, as well. Me and him started off, then I found my roommate. We three made a group chat, picked up a few more people from somewhere and now we have a friend group.

Although all three expressed sadness for not being able to see each other and their current peers as much.

Since fifth grade, weve been in the same aligned classes, so weve all been taking (advanced placement) classes and advanced classes as long as we remember, Gelivi said. Getting out of that group will be a whole new atmosphere.

Allen said the people is what hell miss most about high school.

Were probably not going to see each other often, realistically, he explained. Ive gotten so used to seeing the same people for the past eight years. Literally since middle school Ive seen the same people every day, so itll be a real change for sure.

Gelivi has realized how often children need their parents.

I feel like in college were going to realize we took them for granted, and were going to have to figure out everything by ourselves, she said. Its going to be a new environment well have to work hard through.

Breaking the tie

All schools determine a valedictorian, as theyre required by the state to submit that students information for financial aid opportunities. However, prior to 2018, the district only publically recognized the top two percent.

The districts board policy on breaking a tie reads, In case of a tie for recognition as valedictorian and salutatorian in weighted GPAs after calculation to the second decimal place, the District shall calculate an unweighted numerical grade average using grades earned in all eligible courses taken by each student involved in the tie.

If the tie is not broken after applying these methods, the District shall recognize all students involved in the tie as sharing the honor and title.

Gelivi has been named this years valedictorian.

The rest is here:
Meet the 3 who landed in 1st place for Port Neches-Groves' graduating class - Port Arthur News - The Port Arthur News

Automated Biochemical Analyzers Market 2022 Competitive Situation among the Top Manufacturers Beckman Coulter, Hitachi, Roche Queen Anne and Mangolia…

Global Automated Biochemical Analyzers Market Industry Research Report Focuses Market Size, Share, Growth, Manufacturers and Forecast to 2026. Automated Biochemical Analyzers Market Research Report primarily based upon factors on which the companies complete in the market and this factor which is useful and valuable to the business. This report has published stating that the Global Automated Biochemical Analyzers Market is anticipated to expand significantly during the forecast period.

According recently published report, the global Automated Biochemical Analyzers market is forecast from USD XX to reach approximately USD XX by 2026, growing at a CAGR of around 6% forecast period (2022-2026).

Get Sample Report with Latest Industry Trends:

https://www.reportsnmarkets.com/request_sample.php?id=146549&Utm=BRG

Top Key Players Covered in This Report:

Beckman Coulter, Hitachi, Roche, KHB, Thermo Scientific, Dirui, Toshiba, Gaomi Caihong, Sunostik, Urit, Mindray Medical, Abbott, Senlo, Tecom Science, Siemens Healthcare, Rayto, and others

Product Segments

Floor-standing

Bench-top

Application Segments

Primary Hospital

Prefectural Hospital

Provincial Hospital

These segments are thoroughly evaluated on an individual basis and a team of analysts has ensured to give a crystal clear idea about various lucrative segments of the industry. This detailed analysis using segmentation by providing precise results on industry-related markets.

The report also analyzed the evolution of industry trends. Several macroeconomic factors such as Gross domestic product (GDP) and the increasing inflation rate is expected to affect directly or indirectly in the development of the Automated Biochemical Analyzers industry.

The scope of the Global Automated Biochemical Analyzers Market report is as follows the report provides information on growth segments and opportunities for investment and Benchmark performance against key competitors. Geographically, the global Automated Biochemical Analyzers market has been segmented into four regions such as North America, Europe, Asia Pacific and the rest of the world.

Get Reasonable Discount on this Premium Report (Upto 30% discount):

https://www.reportsnmarkets.com/ask-for-discount.php?id=146549&Utm=BRG

Finally, all aspects of the Global Automated Biochemical Analyzers Market are quantitatively as well qualitatively assessed to study the Global as well as regional market comparatively. This market study presents critical information and factual data about the market providing an overall statistical study of this market on the basis of market drivers, limitations and its future prospects. The report supplies the international economic competition with the assistance of Porters Five Forces Analysis and SWOT Analysis.

Table of contents:

Part 1. SummaryPart 2. Report MethodologyPart 3. Market OverviewPart 4. Industry Value ChainPart 5. Competitive LandscapePart 6. Segmentation by TypePart 7. Segmentation by ApplicationPart 8. Regional PerspectivesPart 9. Company ProfilesPart 10. Market ForecastPart 11. Market DriversPart 12. Industry ActivityPart 13. Appendix

Description of report available at:

https://www.reportsnmarkets.com/report/COVID-Version-Global-Automated-Biochemical-Analyzers-Market-Status-2016-2020-and-Forecast-2021E-2026F-by-Region-Product-Type-End-Use-146549?Mode=BRG

About us:

ReportsNMarkets offers premium progressive statistical surveying, market research reports, analysis & forecast data for industries and governments around the globe. ReportsNmarkets understand how essential statistical surveying information is for your organization or association. Therefore, we have associated with the top publishers and research firms all specialized in specific domains, ensuring you will receive the most reliable and up to date research data available. We also provide COTS (Commercial off the Shelf) business sector reports as custom exploration agreeing your particular needs.

Contact us:

APAC +91-814-979-2504

USA +1-617-671-0092

sales@reportsnmarkets.com

http://www.reportsnmarkets.com

Read more:
Automated Biochemical Analyzers Market 2022 Competitive Situation among the Top Manufacturers Beckman Coulter, Hitachi, Roche Queen Anne and Mangolia...

Bio-Based Platform Chemicals Market 2022 : SWOT Study, Sales Analysis, and Forcast to 2030 | Zhejiang Guoguang Biochemistry Co. Ltd, Reverdia, Cargill…

Bio-Based Platform Chemicals Growth 2021-2030, Covid19 Outbreak Impactresearch report added by Report Ocean, is an in-depth analysis of market characteristics, size and growth, segmentation, regional and country breakdowns, competitive landscape, market shares, trends and strategies for this market. It traces the markets historic and forecast market growth by geography. It places the market within the context of the wider Bio-Based Platform Chemicals, and compares it with other markets., market definition, regional market opportunity, sales and revenue by region, manufacturing cost analysis, Industrial Chain, market effect factors analysis, Bio-Based Platform Chemicals size forecast, market data & Graphs and Statistics, Tables, Bar &Pie Charts, and many more for business intelligence.Getcomplete Report (Including Full TOC, 100+ Tables & Figures, and Chart). In-depth Analysis Pre & Post COVID-19 MarketOutbreak Impact Analysis &Situation by Region

A release on June 8th, 2021, by the Bureau and Economic Analysis and U.S. The Census Bureau reports the recovery of the U.S. market. The report also described the recovery of U.S. International Trade in July 2021.In April 2021, exports in the country reached $300 billion, an increase of $13.4 billion. In April 2021, imports amounted to $294.5 billion, increasing by $17.4 billion. COVID19 is still a significant issue for economies around the globe, as evidenced by the year-over-year decline in exports in the U.S. between April 2020 and April 2021 and the increase in imports over that same period of time. The market is clearly trying to recover. Despite this, it means there will be a direct impact on the Healthcare/ICT/Chemical industries, resulting in a large market forBio-Based Platform Chemicals.

Get a Sample PDF copy of the report @https://reportocean.com/industry-verticals/sample-request?report_id=18970

The Global Bio-Based Platform Chemicals Market is currently witnessing a higher growth in the recent years. The increasing efforts of making the best use of the sustainable materials, the bio based chemicals are high in demand in the current market. It has been estimated that by the end of the year 2018, the bio-based platform chemicals of more than 3,700 kilo tons is projected to be produced. This type of chemical finds its applications in different manufacturing industries. Currently, a huge range of products including solvents, pharmaceutical and solvents contains tha bio-based platforms chemicals. Currently, there is a huge opportunity for the bio-based chemical platforms which has not been explored yet. However, there are several companies who specialize in the field of platform chemicals have recently started exploring deeper into the bio-based chemical platforms.

Market segmentation

The Global Bio-Based Platform Chemicals Market is classified on the basis of type, application and regional demand. Based on its type, the market is segmented into syngas, sugar, algae, biogas, oil and others. On the basis of its application, the global market has been bifurcated into solvents, polymers, fuels, perfumes, pharmaceutical and others.

Request To Download Sample of This Strategic Report:-https://reportocean.com/industry-verticals/sample-request?report_id=18970

Regional analysis

Geographically, the Global Bio-Based Platform Chemicals Market is divided into global regions like Europe, North America, Asia- Pacific, Middle East, LATAM, and Africa.

Major players

Zhejiang Guoguang Biochemistry Co. Ltd, Reverdia, Cargill Incorporated, BioAmber Inc., Braskem, Qingdao Kehai Biochemistry Co. Ltd., AVA Biochem AG, Royal DSM NV, Itaconix PLC, GFBiochemicals Ltd, BASF SE,GC Innovation America, Mitsubishi Chemical Corporation, LyondellBasell Industries NV, are some of the major players operating in the Global Bio-Based Platform Chemicals Market.

Table of Contents:Market Overview Market Dynamics Associated Industry Assessment Market Competitive Landscape Analysis of Leading Companies Market Analysis and Forecast, By Product Types Market Analysis and Forecast, By Applications Market Analysis and Forecast, By Regions Conclusions and Recommendations Appendix

Access full Report Description, TOC, Table of Figure, Chart, etc. @https://reportocean.com/industry-verticals/sample-request?report_id=18970

Our market research provides vital intelligence on market size, business trends, industry structure, market share, and market forecasts that are essential to developing business plans and strategy.

A combination of factors, including COVID-19 containment situation, end-use market recovery & Recovery Timeline of 2020/ 2021

Under COVID-19 Outbreak Impact Analysis:We analyzed industry trends in the context of COVID-19. We analyzed the impact of COVID-19 on the product industry chain based on the upstream and downstream markets. We analyze the impact of COVID-19 on various regions and major countries.The impact of COVID-19 on the future development of the industry is pointed out.

The Study ExploreCOVID 19 Outbreak Impact AnalysisWhat should be entry strategies, countermeasures to economic impact, and marketing channels? What are market dynamics? What are challenges and opportunities? What is economic impact on market? What is current market status? Whats market competition in this industry, both company, and country wise? Whats market analysis by taking applications and types in consideration?

Key questions answered:Study ExploreCOVID 19 Outbreak Impact Analysis

Download Free Sample Report, SPECIAL OFFER (Avail an Up-to 30% discount on this report-https://reportocean.com/industry-verticals/sample-request?report_id=18970

The study objectives of this report are:To study and analyse the global market size (value & volume) by company, key regions/countries, products and application, history data, and forecast to 2025. To understand the structure of market by identifying its various subsegments. To share detailed information about the key factors influencing the growth of the market (growth potential, opportunities, drivers, industry-specific challenges and risks). Focuses on the key global manufacturers, to define, describe and analyse the sales volume, value, market share, market competition landscape, SWOT analysis and development plans in next few years. To analyse the growth trends, future prospects, and their contribution to the total market. To project the value and volume of submarkets, with respect to key regions (along with their respective key countries). To analyse competitive developments such as expansions, agreements, new product launches, and acquisitions in the market. To strategically profile the key players and comprehensively analyze their growth strategies.

Geographical Breakdown:The regional and country breakdowns section gives an analysis of the market in each geography and the size of the market by geography and compares their historic and forecast growth. It covers the impact and recovery path of Covid 19 for all regions, key developed countries and major emerging markets.

Request Full Report-https://reportocean.com/industry-verticals/sample-request?report_id=18970

Countries:Argentina, Australia, Austria, Belgium, Brazil, Canada, Chile, China, Colombia, Czech Republic, Denmark, Egypt, Finland, France, Germany, Hong Kong, India, Indonesia, Ireland, Israel, Italy, Japan, Malaysia, Mexico, Netherlands, New Zealand, Nigeria, Norway, Peru, Philippines, Poland, Portugal, Romania, Russia, Saudi Arabia, Singapore, South Africa, South Korea, Spain, Sweden, Switzerland, Thailand, Turkey, UAE, UK, USA, Venezuela, Vietnam

In-Depth Qualitative COVID 19 Outbreak Impact Analysis Include Identification And Investigation Of The Following Aspects:Market Structure, Growth Drivers, Restraints and Challenges, Emerging Product Trends & Market Opportunities, Porters Fiver Forces. The report also inspects the financial standing of the leading companies, which includes gross profit, revenue generation, sales volume, sales revenue, manufacturing cost, individual growth rate, and other financial ratios. The report basically gives information about the Market trends, growth factors, limitations, opportunities, challenges, future forecasts, and details about all the key market players.

About Report Ocean:

We are the best market research reports provider in the industry. Report Ocean believes in providing quality reports to clients to meet the top line and bottom line goals which will boost your market share in todays competitive environment. Report Ocean is a one-stop solution for individuals, organizations, and industries that are looking for innovative market research reports.

Request Full Report-https://reportocean.com/industry-verticals/sample-request?report_id=18970

Get in Touch with Us:

Report Ocean:

Email:sales@reportocean.com

Address: 500 N Michigan Ave, Suite 600, Chicago, Illinois 60611 UNITED STATES Tel: +1 888 212 3539 (US TOLL FREE) Website:https://www.reportocean.com/

Go here to read the rest:
Bio-Based Platform Chemicals Market 2022 : SWOT Study, Sales Analysis, and Forcast to 2030 | Zhejiang Guoguang Biochemistry Co. Ltd, Reverdia, Cargill...

Detection of failure patterns using advanced imaging in patients with biochemical recurrence following low-dose-rate brachytherapy for prostate cancer…

This article was originally published here

Brachytherapy. 2022 May 3:S1538-4721(22)00045-9. doi: 10.1016/j.brachy.2022.03.009. Online ahead of print.

ABSTRACT

PURPOSE/OBJECTIVE(S): This study describes the pattern of failure in patients with biochemical (BCR) recurrence after low-dose-rate (LDR) brachytherapy as a component of definitive treatment for prostate cancer.

METHODS: Patients with BCR after LDR brachytherapy external beam radiation therapy (EBRT) were enrolled on prospective IRB approved advanced imaging protocols. Patients underwent 3T multiparametric MRI (mpMRI); a subset underwent prostate specific membrane antigen (PSMA)-based PET/CT. Pathologic confirmation was obtained unless contraindicated.

RESULTS: Between January 2011 and April 2021, 51 patients with BCR after brachytherapy (n = 36) or brachytherapy + EBRT (n = 15) underwent mpMRI and were included in this analysis. Of 38 patients with available dosimetry, only two had D90<90%. The prostate and seminal vesicles were a site of failure in 66.7% (n = 34) and 39.2% (n = 20), respectively. PET/CT (n = 32 patients) more often identified lesions pelvic lymph nodes (50%; n = 16) and distant metastases (18.8%; n = 6), than mpMRI. Isolated nodal disease (9.8%; n = 5) and distant metastases (n = 1) without local recurrence were uncommon. Recurrence within the prostate was located in the transition zone in 48.5%, central or midline in 45.5%, and anterior in 36.4% of patients.

CONCLUSION: In this cohort of patients with BCR after LDR brachytherapy EBRT, the predominant recurrence pattern was local (prostate seminal vesicles) with frequent occurrence in the anterior prostate and transition zone. mpMRI and PSMA PET/CT provided complementary information to localize sites of recurrence, with PSMA PET/CT often confirming mpMRI findings and identifying occult nodal or distant metastases.

PMID:35523680 | DOI:10.1016/j.brachy.2022.03.009

The rest is here:
Detection of failure patterns using advanced imaging in patients with biochemical recurrence following low-dose-rate brachytherapy for prostate cancer...

Be Open To A Lot of Things: A Brandeis Alum’s Advice on the Biochemistry & Biophysics Program – brandeis.edu

Home / News & Events / Be Open To A Lot of Things: A Brandeis Alums Advice on the Biochemistry & Biophysics Program

August 22, 2022

Sydney Adams | Graduate School of Arts and Sciences

Prior to receiving her PhD in Biochemistry & Biophysics from Brandeis, Karina Herlambang PhD22 studied biochemistry at the University of Wisconsin-Madison, where she worked for Brandeis alumnus Michael Cox PhD79 studying DNA repair mechanisms as a research assistant. She explains, I was still not sure what biochemistry was really all about, but, as time went on, my fascination towards all these proteins that made up who we are as a living organism only grew stronger. I knew that I wanted to spend more time doing research, so I decided to pursue a PhD. Cox spoke nothing but great things about Brandeis, and after speaking with other alums at UW Madison, Brandeis immediately became one of her top choices. She says Brandeis collaborative environment and top quality research along with our, close proximity to Boston, which is the biotech hub in the country helped to finalize her decision.

Herlambang says, The Brandeis community is just really wonderful! Everyone is willing to go above and beyond to help each other out. She went on to say, Every interaction that I had with the faculty at Brandeis has been really positive. She singled out Professor Jeff Gelles for particular praise, for playing a major role in my scientific and personal development. She partially credits her experience to the typically small class size at Brandeis which allowed her to get to know everyone pretty well. Her favorite part of the PhD program was the ability to collaborate with other lab groups from different departmentsnot just within Brandeis but also in other institutions. That really helped me to get helpful input and learn other techniques that otherwise I would not have been exposed to.

Herlambang made use of another Brandeis resource to secure her current role at Intellia Therapeutics. Working with the Professional Development team enabled her to receive crucial feedback on my resume and ask for interview tips. She also says that the Professional Development team initiated connections with Brandeis alums that currently work in some of the companies that I was applying for. Thats how I ended up applying to Intellia Therapeutics, she says. Little did I know, one of my interviewers was actually an alum of my lab, so that made the interview less intimidating.

While Herlambang cant share any of the projects she is currently working on at Intellia Therapeutics as a scientist in the RNA technologies group, she credits her time at Brandeis for helping her prepare for her role. Her work focuses on improving mRNA stability to enhance our gene editing platform. Herlambang says the scientific community at Brandeis challenged me to think critically and allowed me to be exposed to different areas of research. She went on to say that her experience at Brandeis, made me realize how important collaboration is and interdisciplinary research is even more evident in industry.

As for advice for students interested in pursuing a degree from Brandeis Biochemistry & Biophysics program, Herlambang says, Be open to a lot of things and start networking early. Exposing yourself to different areas of research or career path right from the beginning should help you figure out what you really want to do afterward. Being a Brandeisian itself is already a huge advantage. You might not be aware of this but you have this large network like the Brandeis alumni connection that you should take advantage of. It might be intimidating at first to reach out, but most people are willing to help.

Excerpt from:
Be Open To A Lot of Things: A Brandeis Alum's Advice on the Biochemistry & Biophysics Program - brandeis.edu

Meet some of the notable UWMadison graduates of spring 2022 – University of Wisconsin-Madison

By earning a college degree this weekend, thousands of Badgers will have achieved something impressive. Many have left a lasting impact on campus, and some have already made a mark far beyond UWMadison. Here are just a few of those accomplished graduates consider them a small subset of the excellence of the Class of Spring 2022.

Von Dickens Abero Ulsa Photo by Renzy Mae Baloran

Before he knew he wanted to be a lawyer, Von Dickens Abero Ulsa was already passionate about one thing: art. The Philippines native, who goes simply by Von, immigrated with his family toHawaiiin 2009. Art became one of the ways he expressed himself, and he went on to win state, national and even international honors. His art career came to a brief halt while he finished his triple bachelors degree in American studies, English, and history at the University ofHawaiiat Manoa, but studying these fields only improved his creative methods. Using history and research, Von distorts western artistic traditions through a lens of decolonization and indigenization. His work has been exhibited in Los Angeles, Seattle, and Honolulu, including a headlining gig at the 2017 Coachella Arts & Music Festival. Von will be graduating from UW Law School with a business law concentration. Check out his work on Instagram and his website.

From left, Annika, Claudia and Jenna Strand

The Strand triplets of Wauwatosa, Wisconsin, have different majors and different interests, but theyre alike in one important way all three will graduate from UWMadison on May 14. Weve been huge Badger fans for as long as we can remember, says Annika Strand, who isearning a double-major in real estate & urban land economics and finance, investment & banking). Its been fun to go to college together it made the transition much smoother. Claudia is double-majoring in actuarial science and risk management & insurance, while Jenna is studying communication sciences and disorders. Though each of the sisters considered different colleges, they eventually all agreed upon UWMadison for its academic prestige and campus life. Read more about their path to UWMadison here.

Joel Baraka

At the Kyangwali refugee camp in western Uganda where Joel Baraka grew up, not many children get the opportunity to attend school. Baraka, who graduates this semester with a bachelors degree in civil engineering, counts himself among the fortunate, though access to learning resources was still a challenge. To address this, Baraka founded My Home Stars, a Ugandan-based nonprofit with a mission of making education more equitable and accessible to Ugandan refugee children. With his team, Baraka has focused on developing board games that are affordable and help children learn in fun and engaging ways. The nonprofit has raised about $60,000 through grants, donations, and competitions and has supported the learning of more than 5,000 children in Uganda, mostly during the pandemic when schools remained closed. Baraka came to UWMadison through the universitys King-Morgridge Scholars Program. Read more about Barakas good works here.

Christeena Jojo

As captain of the Wisconsin School of Bhangra, Christeena Jojo created and helped plan the first Bhangra competition at UWMadison Madtown Bhangra which drew more than 100 dancers from around the country in 2021 and raised more than $2,000 for charity. Bhangra is a traditional, upbeat folk danceof Northern India, celebrating the culture and heritage of the state of Punjab. JoJo was born in Chicago to immigrant parents from Kerala, India. She is among the first in her family to attend a four-year university and to pursue a career in medicine. She is studying health promotion and health equity and plans to attend medical school.

Dakota Roettger

Student employees help power UWMadison there are nearly 9,000 of them across campus. One of them, Dakota Roettger, has earned recognition far beyond campus. Roettger works part-time at the Office of Student Financial Aid, where he oversees the recruiting, onboarding, and training of other student employees who serve as administrative assistants. Earlier this year, Roettger, of Eau Claire, Wisconsin, was named UWMadisons 2021-22 Student Employee of the Year. He went on to win the Wisconsin title and the 14-state Midwest regional title. Hes featured in a publication of the National Student Employment Association. Roettger is double-majoring in marketing and management & human resources. Upon graduation, he will be joining the marketing team at AlphaSights in New York City.

Tamia Fowlkes

Chances are, youve seen, read, or heard something by Tamia Fowlkes or soon will. The journalism and political science major from Milwaukee already is well-known on campus and beyond for her work. She currently serves as an intern for The Rachel Maddow Show on MSNBC and News 3 Now in Madison. She is a student representative for The National Association of Black Journalists and has previously written for The Milwaukee Journal Sentinel, The Wisconsin State Journal, Isthmus, and The Madison Commons. She co-hosts a podcast called Pod-Cast Your Vote that aims to mobilize and empower youth voters. Fowlkes is a 2021 Truman Scholarship finalist and a 2022 Louise Troxell and Teddy Kulby Award winner. This summer, she will intern at USA Today. In the fall, she will begin a masters degree program at Columbia Journalism School.

Max Bobholz

Max Bobholz was watching a television report 10 years ago about how a Ugandan team at the Little League World Series sometimes lacked shoes and often shared bats and baseballs when he realized he had a bunch of old baseball equipment in his garage. A sixth-grader at the time, he founded Angels at Bat, which collects new and used baseball equipment and distributes it to Kenya, Benin, Nigeria, and South Africa tens of thousands of items to date. Bobholz, of Green Bay, has continued running the charity even while attending UWMadison. With the help of the Law & Entrepreneurship Clinic at UW Law School, he was able to establish Angels at Bat as an official 501(c)(3) nonprofit organization. There are now branches of the organization in seven states plus Wisconsin. Bobholz has been featured onCNN Heroes: A Young Wonder Special andCNN Heroes: An All-Star Tribute. He is graduating with two bachelors degrees, one in African cultural studies, the other biology. He plans to pursue a Ph.D. in global or public health.

Susan Kay Baker

Susan Kay Baker, a returning student from Madison, is earning a bachelors degree in history following a journey in higher education that began 50 years ago at UWStevens Point. She took some detours, got married, became a mother and grandmother, and retired in 2020 as a senior outpatient procedural coderat UW Hospital & Clinics. I decided the time was right to complete my degree, she says. Fun fact: Baker had wanted to appear on Jeopardy since she was a little girl. When the dream came true in 2016 at age 62, it was everything shed hoped it would be thrilling, terrifying, panic-inducing, exhilarating, she says. It also left her with an immense feeling of accomplishment.Viewers loved her reactionwhen she won. That is what total shock looks like, she says today.

Henry Obeng

Henry Obeng, an MFA candidate in design studies, textile design and papermaking and photography, recently was awarded a prestigious five-week residency beginning this August with the renowned Oak Spring Garden Foundation in Virginia. The competitive award 700 applied recognizes Obengs work with botanical imagery, handmade paper, and photography. Obeng, who was born in Ghana, has explored in his art his experience of being an international student during the COVID-19 lockdown. He received the2022 Graduate Student Creative Arts Awardfrom the UWMadison Division of the Arts.

Nalah McWhorter

Business major Nalah McWhorter is known for getting things done. Case in point: Two years ago, she identified the need for space at the Wisconsin School of Business (WSB) to support students from historically underrepresented backgrounds, particularly students of color. She wrote a petition seeking multicultural spaces, which led the school to create a committee to develop the idea. This spring, two spaces opened in Grainger Hall designed to promote diversity, equity, and inclusion. McWhorter, of Racine, Wisconsin, is part of the first cohort of the Business Emerging Leaders Program at the WSB and served as president of the Wisconsin Black Student Union during the 2020-21 academic year.

Qianyun (Lexi) Luo

Hawra Aljawad

To make it to the finalist stage for a Rhodes Scholarship is a tremendous honor only the most elite students in the world can claim this accomplishment. Two UWMadison students, Qianyun (Lexi) Luo and Hawra Aljawad, did just that last November. Luo, of Bloomington, Illinois, is earning a bachelors degree in biochemistry and statistics. She has conducted cancer research for four years in two labs, earning co-authorship on three publications. Aljawad, of Qatif, Saudi Arabia, is earning a bachelors degree in chemical engineering and biochemistry. She attended UWMadison on a scholarship awarded by King Abdullah University of Science and Technology in Saudi Arabia to 100 top-tier high school students pursuing their bachelors degrees in the U.S. Beginning her freshman year, Aljawad worked in three labs focused on health research, including ones devoted to understanding Alzheimers disease and the flu virus.

Kyla Vaughan

Kyla Vaughan made news when word got out that shed set a goal for herself in calendar year 2021 of reading a book a day and then surpassed it by reading a total of 392. I guess I did it partly for the bragging rights, but also because I believe that reading about other people is the best way to gain empathy, she says. Vaughan, a double-major in English and history from southwestern Wisconsin, attributes her accomplishment to being a naturally fast reader and making reading a priority. Read more about Vaughans Year of Reading Wildly.

Karma Palzom-Pasha

Karma Palzom-Pashawas born in a refugee camp in Nepal.Her father was part of a group that became known as The Lucky 1,000. The U.S. opened 1,000 spots in 1990 to sponsor Tibetans in refugee camps in India and Nepal for permanent residency in this country. Palzom-Pashas father was among those selected through a lottery. Madison was a major sponsoring area for these refugees. After Palzom-Pashas father secured a job in Madison and earned enough money, he sponsored the rest of the family to come to the United States.Palzom-Pasha stood out in middle school and was selected to be part of UWMadisons Precollege Enrichment Opportunity Program for Learning Excellence, known as PEOPLE. She came to UWMadison, earned a bachelors degree and a masters degree, and is now earning a Ph.D. in U.S. History.With a deep commitment to public service, Palzom-Pasha will be returning to PEOPLE in a leadership role. Shell work on expanding the programs reach and building a bigger pipeline to prepare more first-generation students and students from groups historically underrepresented on this campus to come to UWMadison and succeed here.

Ben Rush

In February 2021, doctoral student BenRush released the first episode of his Deeper Than Data podcast, with the vision of sharing the successes, failures, and journeys of scientists. The podcast explores topics that are common in the human experience but not often discussed in science, including dealing with rejection, combatting imposter syndrome, and feeling isolated, as well as positive aspects, like getting a grant. The podcast has been listened to thousands of times worldwide, and its casual conversations with experts led to the creation of the Badger Talks Podcast. By producing and hosting these podcasts,Rushunintentionally started his entrepreneurial career. He launched Deeper Than Data Media in June 2021. Fellow Badgers Jevin Lortie and Julia Nepper soon joined the team.Rush, of Cincinnati, Ohio, is earning a Ph.D. in nutritional sciences. He hopes to grow the business into a central resource for science podcasting. Read more about Rush here.

Continued here:
Meet some of the notable UWMadison graduates of spring 2022 - University of Wisconsin-Madison

Small molecule mediated inhibition of protein cargo recognition by peroxisomal transport receptor PEX5 is toxic to Trypanosoma | Scientific Reports -…

Protein expression and purification

Gene encoding the TPR domain of T. cruzi PEX5 (347668) was optimized for E. coli codon usage, synthesized by Integrated DNA Technologies (Coralville, USA) and cloned between NcoI and NotI restriction enzyme sites into petHSU vector. The resulting construct contained an N-terminal Hexa-histidine (His6) tag and a SUMO tag. For AlphaScreen the same gene was amplified using forward 5-TACGACCATATGGAAACCAATTATCCTTTTG and reverse 5-TACGACCTC GAGAACCGCCATGTCCTCCAAG primers and cloned into pET-24a(+) vector between NdeI and XhoI restriction sites resulting in a construct containing C-terminal His6-tag.

The relevant plasmid was transformed into E. coli BL21 (DE3). A single colony was inoculated in 50mL LB medium containing 10g/mL kanamycin and incubated overnight at 37C. 5mL of the preliminary culture were used to inoculate 500mL of LB medium supplemented with 50g/mL kanamycin and incubated at 37C. When the OD600 reached 0.8, the culture was cooled to 20C, induced with 1mM isopropyl -d-1-thiogalactopyranoside(IPTG) and the culture was continued overnight. The cells were then harvested by centrifugation and resuspended in lysis buffer containing 50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol, 40M AEBSF-HCL (protease inhibitor), 1g/mL DNAaseI and lysed on ice by sonication. The lysate was clarified by ultracentrifugation. The supernatant was applied to a HiTrap IMAC column pre-equilibrated with the lysis buffer and washed with abundant washing buffer (50mM Hepes pH 7.5, 300mM NaCl, 20mM imidazole, 10mM -mercaptoethanol). The His-SUMO tag was cleaved off overnight, directly on column, using dtUD1 protease. The flow-through was then collected, concentrated to 5mL using a 30kDa cutoff Amicon Ultra filter and applied to a size exclusion chromatography on High load S75 pre-equilibrated with 20mM Hepes pH 7.5, 100mM NaCl and 5mM -mercaptoethanol. 6-His-tagged TcPEX5 variant was concentrated to 5mL and further purified by size exclusion chromatography on High load S75 pre-equilibrated with PBS supplemented with -mercaptoethanol straight after being eluted from HiTrap IMAC column. The protocol yielded on average 30mg of TcPEX5 from 1L of bacterial culture.

Perdeuterated 15N-labelled TcPEX5 was expressed in M9 minimal medium prepared in D2O and containing 15N-ammoniun chloride as the sole nitrogen source. 5mL of preliminary culture were used to inoculate 500mL of the same medium. Cells were grown at 37C until the OD600 reached 0.8, the culture was cooled to 18C, induced with 1mM IPTG and maintained overnight. The pellets were collected and the protein was purified as described above. In the last step of purification, the protein was applied to a size exclusion chromatography on S75 pre-equilibrated with NMR buffer (50mM phosphate buffer pH 7.4, 150mM NaCl and 5mM -mercaptoethanol).

All FP measurements were performed on a multifunctional microplate reader (Tecan InfinitePro F200 plate) in Corning NBSblack 96-well or 384-well NBS microplates. 485-nm excitation and 535-nm emission filters were used. The FP values were calculated as follows:

$$FP=frac{{I}_{parallel }-{I}_{perp }}{{I}_{parallel }+ {I}_{perp }}$$

where ({I}_{parallel }) and ({I}_{perp }) are the emission light intensity parallel and perpendicular to the excitation light plane, respectively. Fluorescence polarization values were expressed in millipolarization units (mP).

In the FP saturation binding experiment, 10nM 6-FAM-labelled PTS1 (6-FAM-YQSKL) was mixed with increasing concentrations of TcPEX5 (0.1250nM) in FP buffer containing 10mM Hepes pH 7.5, 100mM NaCl and 5% DMSO. Each data point was determined in triplicate. The FP values were plotted against the log10 of the protein concentration, and the dissociation constant (Kd) was obtained by fitting the experimental data using an equation representing a one site non-cooperative ligand binding:

$$FP={FP}_{min}times frac{left({FP}_{max}- {FP}_{min}right)times c}{{K}_{d}+c}$$

where FP is the determined value of the fluorescence polarization, FPmin is the value of the fluorescence polarization of the peptide alone, FPmax is the maximum value of the fluorescence polarization (saturation), Kd is the dissociation constant and c is the protein concentration.

Competitive binding experiment was performed at 10nM 6-FAM-labeled PTS1 and TcPEX5 concentration yielding f0=0.8 according to Huang18. An in-house 30,000 molecules diversity set (ChemBridge, ChemDiv, Enamine, PPI) and FDA-approved drug library were used in high throughput screening. The selection criteria for the diversity libraries are: (i) diversity within each library and between the 3 diversity sets; (ii) MW<600g/mol; (iii) compounds with acceptable logS/logP for solubility; (iv) Lipinskis rule of 5; (v) Purity>90%. Reactive, unstable and toxic chemical groups, chemotypes of known acute or chronic toxicity and trivial compounds present in commercial random libraries have been filtered out. Each tested compound (50mM in DMSO) was transferred into each well of 384-well assay plate with a robotic delivery system. Mixtures containing 30nM TcPEX5 and 10nM 6-FAM-PTS1 were dispensed into the compound containing wells with a reagent dispenser. In each assay plate, DMSO and unlabeled PTS peptide were used as negative and positive controls, respectively. Wells containing 10nM 6-FAM-PTS1 only were used as additional controls. The inhibitory activities were calculated using the following equation: %Inhibition=100(mPnmPs)/(mPnmPp); where mPn, mPp, and mPs represent FP values of the negative controls, positive controls, and compound samples, respectively.

Prior to HTS the assay performance was evaluated using Z test according to19:

$${Z}^{{prime}}=frac{1-(3{SD}_{n}+3 {SD}_{p})}{{mu }_{n}-{mu }_{p}}$$

where SDn and SDp are the standard deviations, and n and p represent the means of the FP values obtained from the negative and positive controls, respectively. For this test each 384-well plate contained 190 negative control wells (labelled peptide and protein), 190 positive control wells (labeled peptide, protein, and unlabeled PTS1), and four 6-FAM-PTS1 only wells. All experiments were repeated three times.

1H, 15N heteronuclear single quantum coherence (HSQC) spectra were measured for uniformly perdeuterated 15N-labeled TcPEX5 (120M) in the absence or presence of ligands at 1:1 protein:ligand molar ratio. 10% (v/v) of D2O was added to the samples to provide the lock signal. Water suppression was carried out using the WATERGATE sequence20. All spectra were recorded at 298K using a Bruker Avance 600MHz spectrometer with a cryogenic TCI probehead. 1H15N heteronuclear correlations were obtained using the SOFAST-HSQC experiment21. Spectra were processed and visualized using TopSpin 4.0.2.

AlphaScreen assay was used as an orthogonal assay to test the ability of compounds of interest to dissociate PEX5PTS1 interaction. 100nM N-His-PEX5 was mixed with 50nM biotinylated PTS1 (YQSKL) in a PBS buffer supplemented with 5mg/mL of BSA and 0.01% (v/v) Tween-20. 5g/mL of streptavidin donor beads and 5g/mL of nickel chelate acceptor beads (PerkinElmer) were added to the mixture. For EC50 determination, serial dilutions of the inhibitors prepared in DMSO were added while keeping constant concentration of DMSO at 5% (this concentration was shown to have no effect on the assay readout). Signal was determined according to the bead manufacturer instructions. Data were analyzed using Origin Pro 9.0. Experimental points were interpreted using Hill sigmoidal fitting fixing the asymptotes at the maximal assay signal (no inhibitor added) and 0, respectively.

The trypanocidal activity of tested compounds was evaluated against T. brucei brucei bloodstream form (BSF) using resazurin-based 96-well plate assay. T. b. brucei BSF (Lister 427, MITat 1.2) parasites were grown in HMI-11 medium containing 10% fetal bovine serum (FBS) at 37C at 5% CO2. 1:1 serial dilutions (10 points) were prepared in quadruplicates for each compound in HMI-11 medium (100L/well). Additionally, each row contained a well without a compound and one with medium solely as controls. 100L of parasite cultures (4103/mL) were inoculated in all wells (except the control with medium alone) so that the final concentration of parasites was 2103/mL. The plates were incubated for 66h. 25L of 0.1mg/mL resazurin (in Hanks Balanced Salt Solution) was added to each well and further incubated till 72h timepoint. The reduction of resazurin was detected by following the fluorescence emission at 585nm (excitation 530nm) using a Synergy H1 microplate reader. The fluorescence emission of the well containing medium only was considered as background and subtracted from the fluorescence emission of other wells; then the percent survival values were calculated setting the fluorescence emission of the well without the compound at 100% survival. Experimental data points were fitted with a non-linear regression using GraphPad (6.04) and the half-maximal inhibitory concentration (IC50) values were derived from the corresponding sigmoidal doseresponse curves.

Original post:
Small molecule mediated inhibition of protein cargo recognition by peroxisomal transport receptor PEX5 is toxic to Trypanosoma | Scientific Reports -...

Scientists Discover Surprise Anticancer Properties of Common Lab Molecule | Newsroom – UNC Health and UNC School of Medicine

Experiments from the UNC School of Medicine lab of Nobel Prize-winning scientist Aziz Sancar, MD, PhD, show how a common molecular tool for DNA labeling also has anticancer properties worthy of further investigation, especially for brain cancers.

CHAPEL HILL, NC Scientists at the UNC School of Medicine have made the surprising discovery that a molecule called EdU, which is commonly used in laboratory experiments to label DNA, is in fact recognized by human cells as DNA damage, triggering a runaway process of DNA repair that is eventually fatal to affected cells, including cancer cells.

The discovery, published in the Proceedings of the National Academy of Sciences, points to the possibility of using EdU as the basis for a cancer treatment, given its toxicity and its selectivity for cells that divide fast.

The unexpected properties of EdU suggest it would be worthwhile to conduct further studies of its potential, particularly against brain cancers, said study senior author Aziz Sancar, MD, PhD, the Sarah Graham Kenan Professor of Biochemistry and Biophysics at the UNC School of Medicine and member of the UNC Lineberger Comprehensive Cancer Center. We want to stress that this is a basic but important scientific discovery. The scientific community has much work ahead to figure out if EdU could actually become a weapon against cancer.

EdU (5-ethynyl-2-deoxyuridine) is essentially a popular scientific tool first synthesized in 2008 as an analog, or chemical mimic, of the DNA building block thymidine which represents the letter T in the DNA code of adenine (A), cytosine (C), guanine (G) and thymine (T). Scientists add EdU to cells in lab experiments to replace the thymidine in DNA. Unlike other thymidine analogs, it has a convenient chemical handle to which fluorescent probe molecules will bond tightly. It thus can be used relatively easily and efficiently to label and track DNA, for example in studies of the DNA replication process during cell division.

Since 2008, scientists have used EdU as a tool in this way, as published in thousands of studies. Sancar, who won the 2015 Nobel Prize for Chemistry for his seminal work on DNA repair, is one such scientist. When his lab began using EdU, his team unexpectedly observed that EdU-labeled DNA triggered a DNA repair response even when it wasnt exposed to DNA-damaging agents, such as ultraviolet light.

That was quite a shock, Sancar said. So we decided to explore it further.

Following up on the strange observation, the team discovered that EdU, for reasons that are still unclear, alters DNA in a way that provokes a repair response called nucleotide excision repair. This process involves the removal of a short stretch of damaged DNA and re-synthesis of a replacement strand. This is the mechanism that repairs most damage from ultraviolet light, cigarette smoke, and DNA-altering chemo drugs. The researchers mapped EdU-induced excision repair at high resolution and found that it occurs across the genome, and it apparently occurs again and again, since each new repair strand includes EdU and thus provokes the repair response anew.

It had been known that EdU is moderately toxic to cells, though the mechanism of its toxicity had been a mystery. The teams findings strongly suggest that EdU kills cells by inducing a runaway process of futile excision repair, which ultimately leads the cell to terminate itself through a programmed cell-death process called apoptosis.

That discovery was interesting in its own right, Sancar said, because it suggested that researchers using EdU to label DNA need to take into account its triggering of runaway excision repair.

As we speak, hundreds and maybe thousands of researchers use EdU to study DNA replication and cell proliferation in lab experiments without knowing that human cells detect it as DNA damage, Sancar said.

Sancar and colleagues also realized that EdUs properties might make it the basis for an effective brain cancer drug because EdU becomes incorporated into DNA only in cells that are actively dividing, whereas, in the brain, most healthy cells are non-dividing. Thus, in principle, EdU could kill fast-dividing cancerous brain cells while sparing non-dividing, healthy brain cells.

Sancar and his team hope to pursue follow-up collaborations with other researchers to investigate EdUs properties as an anticancer agent.

Prior studies have already found evidence that EdU kills cancer cells, including brain cancer cells, but strangely, no one has ever followed up on those results, Sancar said.

Nucleotide excision repair removes thymidine analog 5-ethynyl-2-deoxyuridine from the mammalian genome was co-authored by Li Wang, Xuemei Cao, Yanyan Yang, Cansu Kose, Hiroaki Kawara, Laura Lindsey-Boltz, Christopher Selby, and Aziz Sancar. Funding was provided by the National Institutes of Health (GM118102, ES02755).

Media contact: Mark Derewicz, UNC School of Medicine, 919-923-0959

View post:
Scientists Discover Surprise Anticancer Properties of Common Lab Molecule | Newsroom - UNC Health and UNC School of Medicine

Board of Visitors summary of actions and discussions – James Madison University

The James Madison University Board of Visitors met Friday, April 22, 2022 in the Festival Conference and Student Center.

The following is a summary of actions taken by the board and key areas of discussion at the board meeting:

Approved the February 18, 2022 Board of Visitors meeting minutes and the personnel action report;

Accepted committee reports from the Academic Excellence, Advancement and Engagement, Athletics, Audit, Governance, Finance and Physical Development, and Student Affairs committees;

An update on the General Assembly was provided by Caitlyn Read, Director of Government Relations;

The 2022-23 proposed tuition and fees and the proposed 2022-23 budget was presented by Towana Moore, Interim Vice President of Administration and Finance;

A reaffirmation of the Universitys mission statement was presented by Brian Charette, Special Assistant to the President;

A racial equity and diversity, equity and inclusion update was provided by Deborah Tompkins Johnson;

Tim Miller, Vice President for Student Affairs led an update on COVID-19;

The Board of Visitors voted to approve the proposed 2022-23 proposed tuition and fees, the 2022-23 proposed summer tuition and fees and the proposed 2022-23 budget, pending the outcome of the state budget;

It was voted by the Board of Visitors that the University reaffirm the current mission statement;

The Board of Visitors voted for the next Rector of the Board to be Maribeth Herod, Vice Rector to be Chris Falcon and Secretary of the Board Donna Harper.

President Alger shared during his Presidents Report:

Link:
Board of Visitors summary of actions and discussions - James Madison University

SMS grad who lives her passion for STEM rewarded with Fulbright Fellowship – ASU News Now

April 26, 2022

Editor's note:This story is part of aseriesof profiles ofnotablespring 2022 graduates.

Miriam Goras has always been fascinated by simple, fundamental questions relating to how nature works, and during her first semester as a sophomore at Arizona State University she began a research regime investigating the underpinnings of Alzheimers disease. Double major Miriam Goras was recently awarded a prestigious Fulbright fellowship to conduct research in Norway. Download Full Image

I decided to pursue a biochemistry and neuroscience double major because they are research-intensive and I wanted to be able to closely connect the material I learned in the classroom with what I was doing in the lab, explained Goras.

She is about to graduate from the School of Molecular Sciences (SMS) and Barrett, The Honors College with a double major in biochemistry and neuroscience. She has also recently been awarded a prestigious Fulbright fellowship to conduct research in Norway.

Goras has received multiple honors and awards while attending ASU including the 2021 SMS Moeller Award.

This scholarship provides me with the opportunity to get involved in outreach programs for young women who may not have many female role models in STEM as happened to me growing up, Goras said.

As one of ASUs Lincoln Scholars, Goras put into practice her passion for equity in STEM.

She started small by becoming a member of Education for Humanity, where she mentored young female college students in science to help them navigate their way through their college endeavors.

Goras was also named a SOLUR undergraduate research fellow, which allowed her to prioritize her outreach efforts. She has participated in a variety of educational outreach programs to get the younger public excited about recent science and biochemical breakthroughs.

Question: What was your aha moment when you realized you wanted to study the field you majored in?

Answer: I entered college as a biology major I have always been fascinated by simple, fundamental questions about how nature works. The fall semester after my first year at ASU, I joined Professor Paul Colemans lab at the Biodesign Institute. Much of my interest in biochemistry and neuroscience as a field stemmed from what I was learning in the lab investigating the underpinnings of Alzheimers disease. I later decided to pursue a biochemistry and neuroscience double major because they are research-intensive and I wanted to be able to closely connect the material I learned in the classroom with what I was doing in the lab.

Q: Whats something you learned while at ASU in the classroom or otherwise that surprised you or changed your perspective?

A: A valuable lesson that I learned during my time at ASU is that as a scientist, my values and subjectivity inevitably affect my work. However, taking part in ethical discourse will allow me to become aware of my personal biases and identify gaps in my ethical decision-making process in research. Thinking critically about ethical norms will prompt me to examine the aims of my research and determine my responsibilities as a researcher. Recognizing that scientific progress is rooted in creative ethical inquiry, I believe that having my perspective challenged will strengthen the connection between discovery at the bench and innovation in the real world.

Q: Why did you choose ASU?

A: I chose ASU because of the limitless resources and opportunities available, ranging from access to expert faculty to potential scholarships and impactful activities. The culture of diversity and inclusion at ASU encourages growth through cooperation and support. Therefore, I knew coming here would allow me to thrive and develop as an individual and future professional.

Q: Which professor taught you the most important lesson while at ASU?

A: Its difficult to narrow it down to just one professor and one lesson because of all the amazing professors I have had at ASU, but I will mention three of them. Professor Susan Holechek taught me the importance of mentorship, especially as a female in STEM. Of not only having a mentor who supports your goals and wants you to thrive but also serving as a mentor for others and uplifting those who were in the same shoes as you when you started. Professor Scott Lefler of SMS taught me perseverance through some of the most difficult college courses Ive taken at ASU. Professor Samuel McClure taught me the value of pursuing your passions. His enthusiasm for the course subject and for teaching clearly comes through, which is inspiring.

Q: Whats the best piece of advice youd give to those still in school?

A: My best advice is to spend time exploring. I took Spanish/Chicano literature courses, dance classes and even graduate seminars, all of which enriched my experience at ASU. There are so many amazing classes at ASU, it is important to take advantage of them.

Q: What was your favorite spot on campus, whether for studying, meeting friends or just thinking about life?

A: My favorite place to study on campus is Hayden Library on the second floor. Nothing beats studying by windows where you can enjoy a beautiful view of campus or watch the sunset at night.

Q: What are your plans aftergraduation?

A: I have recently been awarded a Fulbright fellowship to conduct research in Norway and was accepted into the interdepartmental graduate program at Northwestern University to pursue a doctorate in neuroscience. I will do both, because Northwestern gave me permission to defer my enrollment until after I complete the Fulbright work.

Q: If someone gave you $40 million to solve one problem on our planet, what would you tackle?

A: I would spend the money on efforts to make education more accessible and equitable. Everyone should have access to high-quality education regardless of income, gender, location, race or background. Through equitable education, you empower more people to become critical thinkers and problem solvers who apply their knowledge to complex and novel challenges.

Read the rest here:
SMS grad who lives her passion for STEM rewarded with Fulbright Fellowship - ASU News Now

Provost honours 33 professors with Distinguished awards – McGill Reporter – McGill Reporter

McGill has bestowed internal recognition awards on three cohorts of McGill professors. Nine senior scholars received James McGill Professor (JMP) awards. Thirteen tenure-track assistant or associate professors received William Dawson Scholar (WDS) awards, five for a second five-year term. Eleven scholars became Distinguished James McGill Professors (DJMP)McGills highest honourawarded to late-career scholars whose work exemplifies excellence and international leadership.

McGill is home to outstanding scholars doing excellent research on some of the worlds greatest challenges. Each year, I am honoured to congratulate the winners of the WDS, JMP and DJMP awards and to spotlight the research leadership of these highly accomplished individuals, said Christopher Manfredi, Provost and Vice-Principal (Academic). My sincere congratulations to all the honourees.

Among those who received the Distinguished James McGill Professor award are Dr. Louise Pilote of the Faculty of Medicine and Health Sciences, and Gregory Dudek of the Faculty of Science. A leader in womens cardiovascular health research, Dr. Pilote was recently appointed as Deputy Director of the Research Institute of the McGill University Health Centre (RI-MUHC). Professor Dudek is a globally recognized expert in AI and robotics who serves as vice-president of research at Samsung Electronics and leads the Samsung AI Center Montral, which recently doubled the size of its state-of-the-art facility and increased its team of research scientists.

The James McGill Professor awardees in 2022 include Bioresource Engineering Professor Valrie Orsat, an internationally-recognized expert in the development of functional foods, also known as nutraceuticals, in efforts to address global food security and safety challenges. Last year she received an Engineering and Physical Sciences Suffrage Science award for research excellence and for her role as a mentor for women entering the field. Another JMP awardee is Martin Schmeing, a professor in the Department of Biochemistry, who in 2020 co-led the team that developed a McGill-made version of the RT-PCR (reverse transcription polymerase chain reaction) test for COVID-19, the gold standard for identifying infections. The team produced over 15,000 tests for use by the MUHC testing facility and then set an ambitious goal to provide millions of RT-PCR tests to the Canadian government.

The William Dawson Scholar(WDS) award recognizes a scholar developing into an outstanding and original researcher who is poised to become an internationally recognized leader in their field. Among the newly appointed WDS awardees is Wendell Nii Laryea Adjetey whose first monograph, Cross-Border Cosmopolitans: The Making of a Pan-African North America, published this year, stems from his doctoral dissertation which won Yale Universitys Edwin M. Small Prize for outstanding contribution to U.S. history, Sylvia Ardyn Boone Prize for African American Studies, the Canadian Studies Prize, and the Willard Woody Brittain, Jr. Award. The book situates fundamental questions of twentieth-century U.S. historyimmigration, civil rights, racial identity, radicalism, surveillance and state powerwithin a North American diasporic frame.

Both the JMP and WDS awards come with an annual salary supplement and an annual research allowance not exceeding $25,000. The Distinguished James McGill Professor award provides for a $10,000 academic stipend or a $15,000 research grant allowance. DJMPs have held James McGill Professorships for two seven-year terms while maintaining an outstanding research record, or have held a Canada Research Chairs (Tier 1) for two seven-year terms. DJMP awardees hold the distinction until retirement, and those granted Emeritus status retain the title.

The 2022 DJMP, JMP and WDS cohort:

Distinguished James McGill Professors 11 honourees:

James McGill Professors 9 honourees:

William Dawson Scholar 13 honourees:

A current listing of all DJMP, JMP and WDS awardees:

Read the original post:
Provost honours 33 professors with Distinguished awards - McGill Reporter - McGill Reporter