4Paradigm Defends its Championship in China’s Machine Learning Platform Market in the 1st Half of 2020, According to IDC – Yahoo Finance

4Paradigm stays on a leadership position from 2018 to the first half of 2020

BEIJING, Jan. 21, 2021 /PRNewswire/ -- IDC, a premier global provider of market intelligence, has recently published China AI Software and Application (2020 H1) Report (hereinafter referred to as "Report"), where 4Paradigm as an AI innovator recognized for its software standardization level, scope of industrial coverage and solid customer base, has led China's machine learning platform market from 2018 to the first half of 2020 with expanding market share, ahead of leading vendors such as Alibaba, Tencent, Baidu and Huawei.

The report dives into China's AI market in 2020 in retrospect: from 2015 to 2020, every single year has seen new drivers emerging from the AI market and the market landscape continuously evolving from cognition to exploration, to deep application and then to scale-up. An unprecedentedly prosperous AI market has been witnessed since 2020 as both awareness and investment are boosted for AI and data intelligence in the Chinese market driven by pandemic control, new infrastructure initiatives and impact of international trade frictions. Since the second half 2020, a series of policies such as digital transformation of SOE, intelligent computing center launched by governmental authorities are expected to galvanize AI growth to a new height.

Looking into the future, Yanxia Lu, Chief AI Analyst of IDC China says, "Market opportunities generated from continual AI implementation are just around the corner. For further expansion of market shares, it's necessary to leverage technological leadership and product innovation for new market opportunities, to explore replicable and scalable application scenarios and to unite partners with industrial know-how for deployment of technologies on enterprise."

The IDC report recognizes the advantages of 4Paradigm machine learning platform and AutoML products in technological accumulation, enterprise-level product layout, commercial implementation performance, AI industrial ecosystem, etc., hence an important benchmark for enterprises' choice of machine learning platform.

Story continues

4Paradigm has built an AutoML full stack algorithm layout including perceptive, cognitive and decision-making algorithm, enabling enterprises to drive up key decision-making performance and empowering enterprises to scale up AI scenario deployment with low threshold and high efficiency in all-dimensional observation, accurate orientation and optimized decision-making.

4Paradigm released four products this year, respectively are Sage AIOS, an enterprise AI operation system, Sage HyperCycle ML, a fully automatic tool for scaled-up AI development, Sage CESS, a one-stop intelligent operation platform and Sage One, an AI computing power platform for full life cycle, hence building a full stack AI product matrix covering computing power, OS, production platform and business system.

To help enterprises address the booming demand of moving online, 4Paradigm continues to provide online, intelligent and precise operation capabilities to numerous prominent enterprises and organizations in China and abroad, among which are Bank of Communications, Industrial Bank, Huaxia Bank, Guosen Securities, Laiyifen, Feihe, China Academy of Railway Sciences, DHL, Zegna, Budweiser China, KRASTASE, etc., enabling them to embrace digital transformation and seize new opportunities online.

With over 200 partners in 15 sectors, 4Paradigm is experiencing rapid increase in its eco partners and industrial coverage on the basis of existing ecosystem.

Despite the unprecedent boom on AI market, enterprises face mounting challenges in their intelligent transformation in terms of high development threshold of AI, low implementation efficiency and poor business value. In FutureScape China ICT Market Forecast Forum, an annual IDC event recently held, Zhenshan Zhong, Vice President IDC China, offered elaborated insights on the ten predictions of AI market in China from 2021 to 2025, among which AutoML (automated machine learning) ranks the top. IDC holds that AutoML will lower the threshold of AI development to make inclusive AI a reality. It is expected that the number of data analysts and modelling scientists using AutoML technology encapsulation in providing end-to-end machine learning platforms from data preparation to model deployment will double by 2023.

Through product embedding of AutoML technology and rigorous methodology for implementation, 4Paradigm has built a systematic AutoML implementation solutions and pathways, which have enabled successful implementation of over 10,000 AI applications for enterprises in finance, retail, healthcare, manufacturing, internet, media, government, energy, carrier, among other sectors, with positive feedbacks from leaders and innovators in the tide of transformation. In the future, 4Paradigm will continuously commit to promoting the implementation of machine learning platforms and AutoML products in more industries and scenarios, helping more enterprises in their journey of intelligent transformation and upgrade for higher business efficiency while removing obstacles and boosting social productivity.

http://www.4paradigm.com

SOURCE 4Paradigm

Read more here:
4Paradigm Defends its Championship in China's Machine Learning Platform Market in the 1st Half of 2020, According to IDC - Yahoo Finance

Impact of Covid-19 on Machine Learning as a Service (MLaaS) Market is Projected to Grow Massively in Near Future with Profiling Eminent Players-…

Up-To-Date research on Machine Learning as a Service (MLaaS) Market 2020-2026 :

The Reputed Garner Insights website offers vast reports on different market.They cover all industry and these reports are very precise and reliable. It also offers Machine Learning as a Service (MLaaS) Market Report 2020 in its research report store. It is the most comprehensive report available on this market. The report study provides information on market trends and development, drivers, capacities, technologies, and on the changing investment structure of the Global Machine Learning as a Service (MLaaS) Market.

The study gives a transparent view on the Global Machine Learning as a Service (MLaaS) Market and includes a thorough competitive scenario and portfolio of the key players functioning in it. To get a clear idea of the competitive landscape in the market, the report conducts an analysis of Porters Five Forces Model. The report also provides a market attractiveness analysis, in which the segments and sub-segments are benchmarked on the basis of their market size, growth rate, and general attractiveness.

Request Sample Report of Global Machine Learning as a Service (MLaaS) Market https://garnerinsights.com/Global-Machine-Learning-as-a-Service-MLaaS-Market-Size-Status-and-Forecast-2020-2026#request-sample

Some of the major geographies included in the market are given below:North America (U.S., Canada)Europe (U.K., Germany, France, Italy)Asia Pacific (China, India, Japan, Singapore, Malaysia)Latin America (Brazil, Mexico)Middle East & Africa

Ask For Instant Discount @ https://garnerinsights.com/Global-Machine-Learning-as-a-Service-MLaaS-Market-Size-Status-and-Forecast-2020-2026#discount

Components of the Machine Learning as a Service (MLaaS)Market report:-A detailed assessment of all opportunities and risk in this Market.-Recent innovations and major events-A comprehensive study of business strategies for the growth of the Machine Learning as a Service (MLaaS)leading market players.-Conclusive study about the growth plot of Machine Learning as a Service (MLaaS) Market for the upcoming years.-Understanding of Machine Learning as a Service (MLaaS)Industry-particular drivers, constraints and major micro markets in detail.-An evident impression of vital technological and latest market trends striking theMarket.

The objectives of the study are as follows:

View Full Report @ https://garnerinsights.com/Global-Machine-Learning-as-a-Service-MLaaS-Market-Size-Status-and-Forecast-2020-2026

Contact UsKevin ThomasEmail: [emailprotected]Contact No:+1 513 549 5911 (US) | +44 203 318 2846 (UK)

Read the original post:
Impact of Covid-19 on Machine Learning as a Service (MLaaS) Market is Projected to Grow Massively in Near Future with Profiling Eminent Players-...

Machine Learning as a Service (MLaaS) Market Size Explores Growth Opportunities from 2020 to 2028 – The Think Curiouser

The total % of ICT Goods Exports around the Globe Increased from 11.20% in 2016 to 11.51% in 2017 UNCTAD

CRIFAX added a new market research report onGlobalMachine Learning as a Service (MLaaS) Market, 2020-2028to its database of market research collaterals consisting of overall market scenario with prevalent and future growth prospects, among other growth strategies used by key players to stay ahead of the game. Additionally, recent trends, mergers and acquisitions, region-wise growth analysis along with challenges that are affecting the growth of the market are also stated in the report.

Be it artificial intelligence (AI), internet of things (IoT) or digital reality, the increased rate of technological advancements around the world is directly proportional to the growth of global Machine Learning as a Service (MLaaS) Market. In the next two years, more than 20 billion devices are predicted to be connected to internet. With hundreds of devices getting connected to internet every second, the worldwide digital transformation in various industries is estimated to provide value-producing prospects in the global Machine Learning as a Service (MLaaS) Market, which is further anticipated to significantly boost the market revenue throughout the forecast period, i.e., 2020-2028.

Get Exclusive Sample Report Copy Of This Report @https://www.crifax.com/sample-request-1000774

From last two decades, the investments by ICT industry has contributed extensively in strengthening the developed, developing and emerging countries economic growth. According to the statistics provided by United Nations Conference on Trade and Development (UNCTAD), the total export (%) of ICT goods such as computers, peripheral, communication and electronic equipment among other IT goods around the world grew from 10.62% in 2011 to 11.51% in 2017. The highest was recorded in Hong Kong, with 51.7% in 2017, followed by Philippines, Singapore and Malaysia. Additionally, growth in global economy coupled with various initiatives proposed by governments of different nations to meet their policy objectives is estimated to hone the growth of theGlobal Machine Learning as a Service (MLaaS) Marketin upcoming years.

Not only the ever growing IT sector brings with it numerous advancements, it also creates fair amount of challenges when it comes to security concerns pertaining to data storage among the users. With increasing availability of internet access leading to rising number of internet users, there is vast amount of user information that is being stored online through cloud services. This has driven many nations to compile laws (such as European Unions GDPR and U.S.s CLOUD Act) in an attempt to protect their citizens data. In addition to that, the growth of the global Machine Learning as a Service (MLaaS) Market might also be obstructed by lack of skilled professionals. To overcome this obstacle, companies should focus on providing skills and required training to their workforce, in order to keep up in this digital era.

Download Sample of This Strategic Report:https://www.crifax.com/sample-request-1000774

Furthermore, to provide better understanding of internal and external marketing factors, the multi-dimensional analytical tools such as SWOT and PESTEL analysis have been implemented in the global Machine Learning as a Service (MLaaS) Market report. Moreover, the report consists of market segmentation, CAGR (Compound Annual Growth Rate), BPS analysis, Y-o-Y growth (%), Porters five force model, absolute $ opportunity and anticipated cost structure of the market.

About CRIFAX

CRIFAX is driven by integrity and commitment to its clients, and provides cutting-edge marketing research and consulting solutions with a step-by-step guide to accomplish their business prospects. With the help of our industry experts having hands on experience in their respective domains, we make sure that our industry enthusiasts understand all the business aspects relating to their projects, which further improves the consumer base and the size of their organization. We offer wide range of unique marketing research solutions ranging from customized and syndicated research reports to consulting services, out of which, we update our syndicated research reports annually to make sure that they are modified according to the latest and ever-changing technology and industry insights. This has helped us to carve a niche in delivering distinctive business services that enhanced our global clients trust in our insights, and helped us to outpace our competitors as well.

For More Update Follow:-LinkedIn|Twitter

Contact Us:

CRIFAX

Email: [emailprotected]

U.K. Phone: +44 161 394 2021

U.S. Phone: +1 917 924 8284

More Related Reports:-

Europe Next-generation Organic Solar Cell MarketEurope 5G in Healthcare MarketEurope IoT in Elevators MarketEurope Smart Indoor Garden MarketEurope Com

The total % of ICT Goods Exports around the Globe Increased from 11.20% in 2016 to 11.51% in 2017 UNCTAD

CRIFAX added a new market research report onGlobalMachine Learning as a Service (MLaaS) Market, 2020-2028to its database of market research collaterals consisting of overall market scenario with prevalent and future growth prospects, among other growth strategies used by key players to stay ahead of the game. Additionally, recent trends, mergers and acquisitions, region-wise growth analysis along with challenges that are affecting the growth of the market are also stated in the report.

Be it artificial intelligence (AI), internet of things (IoT) or digital reality, the increased rate of technological advancements around the world is directly proportional to the growth of global Machine Learning as a Service (MLaaS) Market. In the next two years, more than 20 billion devices are predicted to be connected to internet. With hundreds of devices getting connected to internet every second, the worldwide digital transformation in various industries is estimated to provide value-producing prospects in the global Machine Learning as a Service (MLaaS) Market, which is further anticipated to significantly boost the market revenue throughout the forecast period, i.e., 2020-2028.

Get Exclusive Sample Report Copy Of This Report @https://www.crifax.com/sample-request-1000774

From last two decades, the investments by ICT industry has contributed extensively in strengthening the developed, developing and emerging countries economic growth. According to the statistics provided by United Nations Conference on Trade and Development (UNCTAD), the total export (%) of ICT goods such as computers, peripheral, communication and electronic equipment among other IT goods around the world grew from 10.62% in 2011 to 11.51% in 2017. The highest was recorded in Hong Kong, with 51.7% in 2017, followed by Philippines, Singapore and Malaysia. Additionally, growth in global economy coupled with various initiatives proposed by governments of different nations to meet their policy objectives is estimated to hone the growth of theGlobal Machine Learning as a Service (MLaaS) Marketin upcoming years.

Not only the ever growing IT sector brings with it numerous advancements, it also creates fair amount of challenges when it comes to security concerns pertaining to data storage among the users. With increasing availability of internet access leading to rising number of internet users, there is vast amount of user information that is being stored online through cloud services. This has driven many nations to compile laws (such as European Unions GDPR and U.S.s CLOUD Act) in an attempt to protect their citizens data. In addition to that, the growth of the global Machine Learning as a Service (MLaaS) Market might also be obstructed by lack of skilled professionals. To overcome this obstacle, companies should focus on providing skills and required training to their workforce, in order to keep up in this digital era.

Download Sample of This Strategic Report:https://www.crifax.com/sample-request-1000774

Furthermore, to provide better understanding of internal and external marketing factors, the multi-dimensional analytical tools such as SWOT and PESTEL analysis have been implemented in the global Machine Learning as a Service (MLaaS) Market report. Moreover, the report consists of market segmentation, CAGR (Compound Annual Growth Rate), BPS analysis, Y-o-Y growth (%), Porters five force model, absolute $ opportunity and anticipated cost structure of the market.

About CRIFAX

CRIFAX is driven by integrity and commitment to its clients, and provides cutting-edge marketing research and consulting solutions with a step-by-step guide to accomplish their business prospects. With the help of our industry experts having hands on experience in their respective domains, we make sure that our industry enthusiasts understand all the business aspects relating to their projects, which further improves the consumer base and the size of their organization. We offer wide range of unique marketing research solutions ranging from customized and syndicated research reports to consulting services, out of which, we update our syndicated research reports annually to make sure that they are modified according to the latest and ever-changing technology and industry insights. This has helped us to carve a niche in delivering distinctive business services that enhanced our global clients trust in our insights, and helped us to outpace our competitors as well.

For More Update Follow:-LinkedIn|Twitter

Contact Us:

CRIFAX

Email: [emailprotected]

U.K. Phone: +44 161 394 2021

U.S. Phone: +1 917 924 8284

More Related Reports:-

Europe Next-generation Organic Solar Cell MarketEurope 5G in Healthcare MarketEurope IoT in Elevators MarketEurope Smart Indoor Garden MarketEurope Compact Industrial Metal AM Printer MarketEurope Counter Drone MarketEurope 5G Applications and Services MarketEurope Smart Manufacturing Platform MarketEurope Emotion Recognition and Sentiment Analysis MarketEurope Construction & Demolition Robots Market

pact Industrial Metal AM Printer MarketEurope Counter Drone MarketEurope 5G Applications and Services MarketEurope Smart Manufacturing Platform MarketEurope Emotion Recognition and Sentiment Analysis MarketEurope Construction & Demolition Robots Market

See the rest here:
Machine Learning as a Service (MLaaS) Market Size Explores Growth Opportunities from 2020 to 2028 - The Think Curiouser

Amwell CMO: Google partnership will focus on AI, machine learning to expand into new markets – FierceHealthcare

Amwell is looking to evolve virtual care beyond just imitating in-person care.

To do that, the telehealth companyexpects to use its latestpartnership with Google Cloud toenable it to tap into artificial intelligence and machine learning technologies to create a better healthcare experience, according to Peter Antall, M.D., Amwell's chief medical officer.

"We have a shared vision to advance universal access to care thats cost-effective. We have a shared vision to expand beyond our borders to look at other markets. Ultimately, its a strategic technology collaboration that were most interested in," Antall said of the company's partnership with the tech giant during a STATvirtual event Tuesday.

Patient experience and the bottom-line impact on a practice

Practices that deliver exceptional experience often demonstrate strong financial performance and efficient operations. Join us to learn how to identify the most impactful connections between patient experience and financial performance, how to measure, track and improve patient experience as it relates to the bottom line, and identify patient experience measures that affect financial performance.

"What we bring to the table is that we can help provide applications for those technologiesthat will have meaningful effects on consumers and providers," he said.

The use of AI and machine learning can improve bot-based interactions or decision support for providers, he said. The two companies also want to explore the use of natural language processing and automated translation to provide more "value to clients and consumers," he said.

Joining a rush of healthcare technology IPOs in 2020, Amwell went public in August, raising$742 million. Google Cloud and Amwell also announced amultiyear strategic partnership aimed at expanding access to virtual care, accompanied by a$100 million investmentfrom Google.

During an HLTH virtual event earlier this month, Google Cloud director of healthcare solutions Aashima Gupta said cloud and artificial intelligence will "revolutionize telemedicine as we know it."

RELATED:Amwell files to go public with $100M boost from Google

"There's a collective realization in the industry that the future will not look like the past," said Gupta during the HTLH panel.

During the STAT event, Antall said Amwellis putting a big focus onvirtual primary care, which has become an area of interest for health plans and employers.

"It seems to be the next big frontier. Weve been working on it for three years, and were very excited. So much of healthcare is ongoing chronic conditions and so much of the healthcare spend is taking care ofchronic conditionsandtaking care of those conditions in the right care setting and not in the emergency department," he said.

The companyworks with 55 health plans, which support over 36,000 employers and collectively represent more than 80million covered lives, as well as 150 of the nations largest health systems. To date, Amwell says it has powered over 5.6million telehealth visits for its clients, including more than 2.9million in the six months ended June 30, 2020.

Amwell is interested in interacting with patients beyond telehealth visits through what Antall called "nudges" and synchronous communication to encouragecompliance with healthy behaviors, he said.

RELATED:Amwell CEOs on the telehealth boom and why it will 'democratize' healthcare

It's an area where Livongo, recently acquired by Amwell competitor Teladoc,has become the category leader by using digital health tools to help with chronic condition management.

"Were moving into similar areas, but doing it in a slightly different matter interms of how we address ongoing continuity of care and how we address certain disease states and overall wellness," Antallsaid, in reference to Livongo's capabilities.

The telehealth company also wants to expand into home healthcare through the integration of telehealth and remote care devices.

Virtual care companies have been actively pursuing deals to build out their service and product lines as the use of telehealth soars. To this end, Amwell recently deepened its relationship with remote device company Tyto Care. Through the partnership, the TytoHome handheld examination device that allows patients to exam their heart, lungs, skin, ears, abdomen, and throat at home, is nowpaired withAmwells telehealth platform.

Looking forward, there is the potential for patients to getlab testing, diagnostic testing, and virtual visits with physicians all at home, Antall said.

"I think were going to see a real revolution in terms ofhow much more we can do in the home going forward," he said.

RELATED:Amwell's stock jumps on speculation of potential UnitedHealth deal: media report

Amwell also is exploring the use of televisions in the home to interact with patients, he said.

"We've done work with some partners and we're working toward a future where, if it's easier for you to click your remote and initiate a telehealth visit that way, thats one option. In some populations, particularly the elderly, a TV could serve as a remote patient device where a doctor or nurse could proactively 'ring the doorbell' on the TV and askto check on the patient," Antall said.

"Its video technology that'salready there in most homes, you just need a camera to go with it and a little bit of software.Its one part of our strategy to be available for the whole spectrum of care and be able to interact in a variety of ways," he said.

See the original post:
Amwell CMO: Google partnership will focus on AI, machine learning to expand into new markets - FierceHealthcare

5 machine learning skills you need in the cloud – TechTarget

Machine learning and AI continue to reach further into IT services and complement applications developed by software engineers. IT teams need to sharpen their machine learning skills if they want to keep up.

Cloud computing services support an array of functionality needed to build and deploy AI and machine learning applications. In many ways, AI systems are managed much like other software that IT pros are familiar with in the cloud. But just because someone can deploy an application, that does not necessarily mean they can successfully deploy a machine learning model.

While the commonalities may partially smooth the transition, there are significant differences. Members of your IT teams need specific machine learning and AI knowledge, in addition to software engineering skills. Beyond the technological expertise, they also need to understand the cloud tools currently available to support their team's initiatives.

Explore the five machine learning skills IT pros need to successfully use AI in the cloud and get to know the products Amazon, Microsoft and Google offer to support them. There is some overlap in the skill sets, but don't expect one individual to do it all. Put your organization in the best position to utilize cloud-based machine learning by developing a team of people with these skills.

IT pros need to understand data engineering if they want to pursue any type of AI strategy in the cloud. Data engineering is comprised of a broad set of skills that requires data wrangling and workflow development, as well as some knowledge of software architecture.

These different areas of IT expertise can be broken down into different tasks IT pros should be able to accomplish. For example, data wrangling typically involves data source identification, data extraction, data quality assessments, data integration and pipeline development to carry out these operations in a production environment.

Data engineers should be comfortable working with relational databases, NoSQL databases and object storage systems. Python is a popular programming language that can be used with batch and stream processing platforms, like Apache Beam, and distributed computing platforms, such as Apache Spark. Even if you are not an expert Python programmer, having some knowledge of the language will enable you to draw from a broad array of open source tools for data engineering and machine learning.

Data engineering is well supported in all the major clouds. AWS has a full range of services to support data engineering, such as AWS Glue, Amazon Managed Streaming for Apache Kafka (MSK) and various Amazon Kinesis services. AWS Glue is a data catalog and extract, transform and load (ETL) service that includes support for scheduled jobs. MSK is a useful building block for data engineering pipelines, while Kinesis services are especially useful for deploying scalable stream processing pipelines.

Google Cloud Platform offers Cloud Dataflow, a managed Apache Beam service that supports batch and steam processing. For ETL processes, Google Cloud Data Fusion provides a Hadoop-based data integration service. Microsoft Azure also provides several managed data tools, such as Azure Cosmos DB, Data Catalog and Data Lake Analytics, among others.

Machine learning is a well-developed discipline, and you can make a career out of studying and developing machine learning algorithms.

IT teams use the data delivered by engineers to build models and create software that can make recommendations, predict values and classify items. It is important to understand the basics of machine learning technologies, even though much of the model building process is automated in the cloud.

As a model builder, you need to understand the data and business objectives. It's your job to formulate the solution to the problem and understand how it will integrate with existing systems.

Some products on the market include Google's Cloud AutoML, which is a suite of services that help build custom models using structured data as well as images, video and natural language without requiring much understanding of machine learning. Azure offers ML.NET Model Builder in Visual Studio, which provides an interface to build, train and deploy models. Amazon SageMaker is another managed service for building and deploying machine learning models in the cloud.

These tools can choose algorithms, determine which features or attributes in your data are most informative and optimize models using a process known as hyperparameter tuning. These kinds of services have expanded the potential use of machine learning and AI strategies. Just as you do not have to be a mechanical engineer to drive a car, you do not need a graduate degree in machine learning to build effective models.

Algorithms make decisions that directly and significantly impact individuals. For example, financial services use AI to make decisions about credit, which could be unintentionally biased against particular groups of people. This not only has the potential to harm individuals by denying credit but it also puts the financial institution at risk of violating regulations, like the Equal Credit Opportunity Act.

These seemingly menial tasks are imperative to AI and machine learning models. Detecting bias in a model can require savvy statistical and machine learning skills but, as with model building, some of the heavy lifting can be done by machines.

FairML is an open source tool for auditing predictive models that helps developers identify biases in their work. Experience with detecting bias in models can also help inform the data engineering and model building process. Google Cloud leads the market with fairness tools that include the What-If Tool, Fairness Indicators and Explainable AI services.

Part of the model building process is to evaluate how well a machine learning model performs. Classifiers, for example, are evaluated in terms of accuracy, precision and recall. Regression models, such as those that predict the price at which a house will sell, are evaluated by measuring their average error rate.

A model that performs well today may not perform as well in the future. The problem is not that the model is somehow broken, but that the model was trained on data that no longer reflects the world in which it is used. Even without sudden, major events, data drift can occur. It is important to evaluate models and continue to monitor them as long as they are in production.

Services such as Amazon SageMaker, Azure Machine Learning Studio and Google Cloud AutoML include an array of model performance evaluation tools.

Domain knowledge is not specifically a machine learning skill, but it is one of the most important parts of a successful machine learning strategy.

Every industry has a body of knowledge that must be studied in some capacity, especially when building algorithmic decision-makers. Machine learning models are constrained to reflect the data used to train them. Humans with domain knowledge are essential to knowing where to apply AI and to assess its effectiveness.

Read the original here:
5 machine learning skills you need in the cloud - TechTarget

Commentary: Can AI and machine learning improve the economy? – FreightWaves

The views expressed here are solely those of the author and do not necessarily represent the views of FreightWaves or its affiliates.

In this installment of the AI in Supply Chain series (#AIinSupplyChain), I tried to discern the outlines of an answer to the question posed in the headline above by reading three academic papers. This article distills what I consider the most important takeaways from the papers.

Although the context of the investigations that resulted in these papers looks at the economy as a whole, there are implications that are applicable at the level of an individual firm. So, if you are responsible for innovation, corporate development and strategy at your company, its probably worth your time to read each of them and then interpret the findings for your own firm.

In this paper, Erik Brynjolfsson, Daniel Rock and Chad Syverson explore the paradox that while systems using artificial intelligence are advancing rapidly, measured economywide productivity has declined.

Recent optimism about AI and machine learning is driven by recent and dramatic improvements in machine perception and cognition. These skills are essential to the ways in which people get work done. So this has fueled hopes that machines will rapidly approach and possibly surpass people in their ability to do many different tasks that today are the preserve of humans.

However, productivity statistics do not yet reflect growth that is driven by the advances in AI and machine learning. If anything, the authors cite statistics to suggest that labor productivity growth fell in advanced economies starting in the mid-2000s and has not recovered to its previous levels.

Therein lies the paradox: AI and machine learning boosters predict it will transform entire swathes of the economy, yet the economic data do not point to such a transformation taking place. What gives?

The authors offer four possible explanations.

First, it is possible that the optimism about AI and machine learning technologies is misplaced. Perhaps they will be useful in certain narrow sectors of the economy, but ultimately their economywide impact will be modest and insignificant.

Second, it is possible that the impact of AI and machine learning technologies is not being measured accurately. Here it is pessimism about the significance of these technologies that prevents society from accurately measuring their contribution to economic productivity.

Third, perhaps these new technologies are producing positive returns to the economy, BUT these benefits are being captured by a very small number of firms and as such the rewards are enjoyed by only a minuscule fraction of the population.

Fourth, the benefits of AI and machine learning will not be reflected in the wider economy until investments have been made to build up complementary technologies, processes, infrastructure, human capital and other types of assets that make it possible for society to realize and measure the transformative benefits of AI and machine learning.

The authors argue that AI, machine learning and their complementary new technologies embody the characteristics of general purpose technologies (GPTs). A GPT has three primary features: It is pervasive or can become pervasive; it can be improved upon as time elapses; and it leads directly to complementary innovations.

Electricity. The internal combustion engine. Computers. The authors cite these as examples of GTPs, with which readers are familiar.

Crucially, the authors state that a GPT can at one moment both be present and yet not affect current productivity growth if there is a need to build a sufficiently large stock of the new capital, or if complementary types of capital, both tangible and intangible, need to be identified, produced, and put in place to fully harness the GPTs productivity benefits.

It takes a long time for economic production at the macro- or micro-scale to be reorganized to accommodate and harness a new GPT. The authors point out that computers took 25 years before they became ubiquitous enough to have an impact on productivity. It took 30 years for electricity to become widespread. As the authors state, the changes required to harness a new GPT take substantial time and resources, contributing to organizational inertia. Firms are complex systems that require an extensive web of complementary assets to allow the GPT to fully transform the system. Firms that are attempting transformation often must reevaluate and reconfigure not only their internal processes but often their supply and distribution chains as well.

The authors end the article by stating: Realizing the benefits of AI is far from automatic. It will require effort and entrepreneurship to develop the needed complements, and adaptability at the individual, organizational, and societal levels to undertake the associated restructuring. Theory predicts that the winners will be those with the lowest adjustment costs and that put as many of the right complements in place as possible. This is partly a matter of good fortune, but with the right roadmap, it is also something for which they, and all of us, can prepare.

In this paper, Brynjolfsson, Xiang Hui and Meng Liu explore the effect that the introduction of eBay Machine Translation (eMT) had on eBays international trade. The authors describe eMT as an in-house machine learning system that statistically learns how to translate among different languages. They also state: As a platform, eBay mediated more than 14 billion dollars of global trade among more than 200 countries in 2014. Basically, eBay represents a good approximation of a complex economy within which to examine the economywide benefits of this type of machine translation.

The authors state: We show that a moderate quality upgrade increases exports on eBay by 17.5%. The increase in exports is larger for differentiated products, cheaper products, listings with more words in their title. Machine translation also causes a greater increase in exports to less experienced buyers. These heterogeneous treatment effects are consistent with a reduction in translation-related search costs, which comes from two sources: (1) an increased matching relevance due to improved accuracy of the search query translation and (2) better translation quality of the listing title in buyers language.

They report an accompanying 13.1% increase in revenue, even though they only observed a 7% increase in the human acceptance rate.

They also state: To put our result in context, Hui (2018) has estimated that a removal of export administrative and logistic costs increased export revenue on eBay by 12.3% in 2013, which is similar to the effect of eMT. Additionally, Lendle et al. (2016) have estimated that a 10% reduction in distance would increase trade revenue by 3.51% on eBay. This means that the introduction of eMT is equivalent of [sic] the export increase from reducing distances between countries by 37.3%. These comparisons suggest that the trade-hindering effect of language barriers is of first-order importance. Machine translation has made the world significantly smaller and more connected.

In this paper, Brynjolfsson, Rock and Syverson develop a model that shows how GPTs like AI enable and require significant complementary investments, including co-invention of new processes, products, business models and human capital. These complementary investments are often intangible and poorly measured in the national accounts, even when they create valuable assets for the firm AND they develop a model that shows how this leads to an underestimation of productivity growth in the early years of a new GPT, and how later, when the benefits of intangible investments are harvested, productivity growth will be overestimated. Their model generates a Productivity J-Curve that can explain the productivity slowdowns often accompanying the advent of GPTs, as well as the increase in productivity later.

The authors find that, first, As firms adopt a new GPT, total factor productivity growth will initially be underestimated because capital and labor are used to accumulate unmeasured intangible capital stocks. Then, second, Later, measured productivity growth overestimates true productivity growth because the capital service flows from those hidden intangible stocks generates measurable output. Finally, The error in measured total factor productivity growth therefore follows a J-curve shape, initially dipping while the investment rate in unmeasured capital is larger than the investment rate in other types of capital, then rising as growing intangible stocks begin to contribute to measured production.

This explains the observed phenomenon that when a new technology like AI and machine learning, or something like blockchain and distributed ledger technology, is introduced into an area such as supply chain, it generates furious debate about whether it creates any value for incumbent suppliers or customers.

If we consider the reported time it took before other GPTs like electricity and computers began to contribute measurably to firm-level and economywide productivity, we must admit that it is perhaps too early to write off blockchains and other distributed ledger technologies, or AI and machine learning, and their applications in sectors of the economy that are not usually associated with internet and other digital technologies.

Give it some time. However, I think we are near the inflection point of the AI and Machine Learning Productivity J-curve. As I have worked on this #AIinSupplyChain series, I have become more convinced that the companies that are experimenting with AI and machine learning in their supply chain operations now will have the advantage over their competitors over the next decade.

I think we are a bit farther away from the inflection point of a Blockchain and Distributed Ledger Technologies Productivity J-Curve. I cannot yet make a cogent argument about why this is true, although in March 2014, I published #ChainReaction: Who Will Own The Age of Cryptocurrencies? part of an ongoing attempt to understand when blockchains and other distributed technologies might become more ubiquitous than they are now.

Examining this topic has added to my understanding of why disruption happens. The authors of the Productivity J-Curve paper state that the more transformative the new technology, the more likely its productivity effects will initially be underestimated.

The long duration during which incumbent firms underestimate the productivity effects of a relatively new GPT is what contributes to the phenomenon studied by Rebecca Henderson and Kim Clark in Architectural Innovation: The Reconfiguration of Existing Product Technologies and the Failure of Established Firms. It is also described as Supply Side Disruption by Josgua Gans in his book, The Disruption Dilemma, and summarized in this March 2016 HBR article, The Other Disruption.

If we focus on AI and machine learning specifically, in an exchange on Twitter on Sept. 27, Brynjolfsson said, The machine translation example is in many ways the exception. More often it takes a lot of organizational reinvention and time before AI breakthroughs translate into productivity gains.

By the time entrenched and industry-leading incumbents awaken to the threats posed by newly developed GPTs, a crop of challengers who had no option but to adopt the new GPT at the outset has become powerful enough to threaten the financial stability of an industry.

One example? E-commerce and its impact on retail in general.

If you are an executive, what experiments are you performing to figure out if and how your companys supply chain operations can be made more productive by implementing technologies that have so far been underestimated by you and other incumbents in your industry?

If you are not doing anything yet, are you fulfilling your obligations to your companys shareholders, employees, customers and other stakeholders?

If you are a team working on innovations that you believe have the potential to significantly refashion global supply chains, wed love to tell your story in FreightWaves. I am easy to reach on LinkedIn and Twitter. Alternatively, you can reach out to any member of the editorial team at FreightWaves at media@freightwaves.com.

Dig deeper into the #AIinSupplyChain Series with FreightWaves.

Commentary: Optimal Dynamics the decision layer of logistics?

Commentary: Combine optimization, machine learning and simulation to move freight

Commentary: SmartHop brings AI to owner-operators and brokers

Commentary: Optimizing a truck fleet using artificial intelligence

Commentary: FleetOps tries to solve data fragmentation issues in trucking

Commentary: Bulgarias Transmetrics uses augmented intelligence to help customers

Commentary: Applying AI to decision-making in shipping and commodities markets

Commentary: The enabling technologies for the factories of the future

Commentary: The enabling technologies for the networks of the future

Commentary: Understanding the data issues that slow adoption of industrial AI

Commentary: How AI and machine learning improve supply chain visibility, shipping insurance

Commentary: How AI, machine learning are streamlining workflows in freight forwarding, customs brokerage

Authors disclosure: I am not an investor in any early-stage startups mentioned in this article, either personally or through REFASHIOND Ventures. I have no other financial relationship with any entities mentioned in this article.

Read the rest here:
Commentary: Can AI and machine learning improve the economy? - FreightWaves

Zaloni Named to Now Tech: Machine Learning Data Catalogs Report, Announced as a Finalist for the NC Tech Awards, and Releases Arena 6.1 – PR Web

From controlling data sprawl to eliminating data bottlenecks, we believe Arenas birds-eye view across the entire data supply chain allows our clients to reduce IT costs, accelerate time to analytics, and achieve better AI and ML outcomes. - Susan Cook, CEO Zaloni

RESEARCH TRIANGLE PARK, N.C. (PRWEB) October 28, 2020

Zaloni, an award-winning leader in data management, today announced its inclusion in a recent Forrester report, titled Now Tech: Machine Learning Data Catalogs (MLDC), Q4 2020. Forrester, a global research and advisory firm for business and technology leaders, listed Zaloni as a midsize vendor in the MLDC Market in the report.

Defined by Forrester, A machine learning data catalog (MLDC) discovers, profiles, interprets and applies semantics and data policies to data and metadata using machine learning to enable data governance and DataOps, helping analysts, data scientists, and data consumers turn data into business outcomes. Having a secure MLDC foundation is vital for key technology trends -- internet of things (IoT), blockchain, AI, and intelligent security.

As a conclusive remark in the Forrester report: MLDCs will force organizations to address the unique processes and requirements of different data roles. Unlike other data management solutions that seek to process and automate the management of data within systems, MLDCs are workbenches for data consumption and delivery across engineers, stewards, and analyst roles.

For us, to be named a vendor in the MLDC Market by Forrester is a huge accomplishment, expressed CEO of Zaloni, Susan Cook. At Zaloni, we are passionate about making our clients lives easier with our end-to-end DataOps platform, Arena. From controlling data sprawl to eliminating data bottlenecks, we believe Arenas birds-eye view across the entire data supply chain allows our clients to reduce IT costs, accelerate time to analytics, and achieve better AI and ML outcomes.

To receive a complimentary copy of the report, visit: https://www.zaloni.com/resources/briefs-papers/forrester-ml-data-catalogs-2020/.

Zaloni Named NC Tech Award Finalist for Artificial Intelligence and Machine Learning

In addition to the inclusion in the Forrester Report, Zaloni has recently been named a finalist for the NC Tech Associations award for Best Use of Technology: Artificial Intelligence & Machine Learning for the 2020 year. The NC Tech Association recognizes North Carolina-based companies who are making an impact with technology among the state and beyond. Zaloni is looking forward to the NC Tech Award: Virtual Beacons Ceremony where the winners will be announced for all categories.

Zaloni's Arena 6.1 Release Extends Augmented Data Management

Zaloni released the latest version of the Arena platform, Arena 6.1. This release adds new features and enhancements that build upon the 6.0 releases focus on DataOps optimization and augmented data catalog. The latest release adds to the new streamlined user-interface to improve user experience and productivity. It also provides a new feature for importing and exporting metadata through Microsoft Excel.

Traditionally, Microsoft Excel has been a popular tool for managing and exchanging metadata outside of a governance and catalog tool. To jumpstart the process of building a catalog, Arena allows users to add and update catalog entities by uploading Microsoft Excel worksheets containing entity metadata helping to incorporate data catalog updates into existing business processes and workflows with the tools users already know and use.

Zaloni to Present Dataops for Improved AI & ML Outcomes at ODSC Virtual Conference

Zaloni is participating in the ODSC West Virtual Conference this week. Solutions Engineer, Cody Rich, will be presenting Wednesday, October 28th, at 3:30 PM PDT. Codys presentation will consist of a live Arena demo. This demo will walk viewers through our unified DataOps platform that bridges the gap between data engineers, stewards, analysts, and data scientists while optimizing the end-to-end data supply chain to process and deliver secure, trusted data rapidly. In addition to the presentation, Zaloni staff will be hosting a booth in the conferences Exhibitor Hall. If you are interested in learning more about Zaloni and our DataOps driven solutions with the Arena platform, make sure to visit us on Wednesday, October 28th, or Thursday, October 29th.

About ZaloniAt Zaloni, we believe in the unrealized power of data. Our DataOps software platform, Arena, streamlines data pipelines through an active catalog, automated control, and self-service consumption to reduce IT costs, accelerate analytics, and standardize security. We work with the world's leading companies, delivering exceptional data governance built on an extensible, machine-learning platform that both improves and safeguards enterprises data assets. To find out more visit http://www.zaloni.com.

Media Contact:Annie Bishopabishop@zaloni.com

Share article on social media or email:

Continued here:
Zaloni Named to Now Tech: Machine Learning Data Catalogs Report, Announced as a Finalist for the NC Tech Awards, and Releases Arena 6.1 - PR Web

Machine Learning Software is Now Doing the Exhausting Task of Counting Craters On Mars – Universe Today

Does the life of an astronomer or planetary scientists seem exciting?

Sitting in an observatory, sipping warm cocoa, with high-tech tools at your disposal as you work diligently, surfing along on the wavefront of human knowledge, surrounded by fine, bright people. Then one dayEureka!all your hard work and the work of your colleagues pays off, and you deliver to humanity a critical piece of knowledge. A chunk of knowledge that settles a scientific debate, or that ties a nice bow on a burgeoning theory, bringing it all together. ConferencestenureNobel Prize?

Well, maybe in your first year of university you might imagine something like that. But science is work. And as we all know, not every minute of ones working life is super-exciting and gratifying.

Sometimes it can be dull and repetitious.

Its probably not anyones dream, when they begin their scientific education, to sit in front of a computer poring over photos of the surface of Mars, counting the craters. But someone has to do it. How else would we all know how many craters there are?

Mars is the subject of intense scientific scrutiny. Telescopes, rovers, and orbiters are all working to unlock the planets secrets. There are a thousand questions concerning Mars, and one part of understanding the complex planet is understanding the frequency of meteorite strikes on its surface.

NASAs Mars Reconnaissance Orbiter (MRO) has been orbiting Mars for 14.5 years now. Along with the rest of its payload, the MRO carries cameras. One of them is called the Context (CTX) Camera. As its name says, it provides context for the other cameras and instruments.

MROs powerhouse camera is called HiRISE (High-Resolution Imaging Science Experiment). While the CTX camera takes wider view images, HiRISE zooms in to take precision images of details on the surface. The pair make a potent team, and HiRISE has treated us to more gorgeous and intriguing pictures of Mars than any other instrument.

But the cameras are kind of dumb in a scientific sense. It takes a human being to go over the images. As a NASA press release tells us, it can take 40 minutes for one researcher to go over a CTX image, hunting for small craters. Over the lifetime of the MRO so far, researchers have found over 1,000 craters this way. Theyre not just looking for craters, theyre interested in any changes on the surface: dust devils, shifting dunes, landslides, and the like.

AI researchers at NASAs Jet Propulsion Laboratory in Southern California have been trying to do something about all the time it takes to find things of interest in all of these images. Theyre developing a machine learning tool to handle some of that workload. On August 26th, 2020, the tool had its first success.

On some date between March 2010 and May 2012, a meteor slammed into Mars thin atmosphere. It broke into several pieces before it struck the surface, creating what looks like nothing more than a black speck in CTX camera images of the area. The new AI tool, called an automated fresh impact crater classifier, found it. Once it did, NASA used HiRISE to confirm it.

That was the classifiers first find, and in the future, NASA expects AI tools to do more of this kind of work, freeing human minds up for more demanding thinking. The crater classifier is part of a broader JPL effort named COSMIC (Capturing Onboard Summarization to Monitor Image Change). The goal is to develop these technologies not only for MRO, but for future orbiters. Not only at Mars, but wherever else orbiters find themselves.

Machine learning tools like the crater classifier have to be trained. For its training, it was fed 6,830 CTX camera images. Among those images were ones containing confirmed craters, and others that contained no craters. That taught the tool what to look for and what not to look for.

Once it was trained, JPL took the systems training wheels off and let it loose on over 110,000 images of the Martian surface. JPL has its own supercomputer, a cluster containing dozens of high-performance machines that can work together. The result? The AI running on that powerful machine took only five seconds to complete a task that takes a human about 40 minutes. But it wasnt easy to do.

It wouldnt be possible to process over 112,000 images in a reasonable amount of time without distributing the work across many computers, said JPL computer scientist Gary Doran, in a press release. The strategy is to split the problem into smaller pieces that can be solved in parallel.

But while the system is powerful, and represents a huge savings of human time, it cant operate without human oversight.

AI cant do the kind of skilled analysis a scientist can, said JPL computer scientist Kiri Wagstaff. But tools like this new algorithm can be their assistants. This paves the way for an exciting symbiosis of human and AI investigators working together to accelerate scientific discovery.

Once the crater finder scores a hit in a CTX camera image, its up to HiRISE to confirm it. That happened on August 26th, 2020. After the crater finder flagged a dark smudge in a CTX camera image of a region named Noctis Fossae, the power of the HiRISE took scientists in for a closer look. That confirmed the presence of not one crater, but a cluster of several resulting from the objects that struck Mars between March 2010 and May 2012.

With that initial success behind them, the team developing the AI has submitted more than 20 other CTX images to HiRISE for verification.

This type of software system cant run on an orbiter, yet. Only an Earth-bound supercomputer can perform this complex task. All of the data from CTX and HiRISE is sent back to Earth, where researchers pore over it, looking for images of interest. But the AI researchers developing this system hope that will change in the future.

The hope is that in the future, AI could prioritize orbital imagery that scientists are more likely to be interested in, said Michael Munje, a Georgia Tech graduate student who worked on the classifier as an intern at JPL.

Theres another important aspect to this development. It shows how older, still-operational spacecraft can be sort of re-energized with modern technological power, and how scientists can wring even more results from them.

Ingrid Daubar is one of the scientists working on the system. She thinks that this new tool will help find more craters that are eluding human eyes. And if it can, itll help build our knowledge of the frequency, shape, and size of meteor strikes on Mars.

There are likely many more impacts that we havent found yet, Daubar said. This advance shows you just how much you can do with veteran missions like MRO using modern analysis techniques.

This new machine learning tool is part of a broader-based NASA/JPL initiative called COSMIC (Content-based On-board Summarization to Monitor Infrequent Change.) That initiative has a motto: Observe much, return best.

The idea behind COSMIC is to create a robust, flexible orbital system for conducting planetary surveys and change monitoring in the Martian environment. Due to bandwidth considerations, many images are never downloaded to Earth. Among other goals, the system will autonomously detect changes in non-monitored areas, and provide relevant, informative descriptions of onboard images to advise downlink prioritization. The AI that finds craters is just one component of the system.

Data management is a huge and growing challenge in science. Other missions like NASAs Kepler planet-hunting spacecraft generated an enormous amount of data. In an effort that parallels what COSMIC is trying to do, scientists are using new methods to comb through all of Keplers data, sometimes finding exoplanets that were missed in the original analysis.

And the upcoming Vera C. Rubin Survey Telescope will be another data-generating monster. In fact, managing all of its data is considered to be the most challenging part of that entire project. Itll generate about 200,000 images per year, or about 1.28 petabytes of raw data. Thats far more data than humans will be able to deal with.

In anticipation of so much data, the people behing the Rubin Telescope developed the the LSSTC Data Science Fellowship Program. Its a two-year program designed for grad school curriculums that will explore topics including statistics, machine learning, information theory, and scalable programming.

Its clear that AI and machine learning will have to play a larger role in space science. In the past, the amount of data returned by space missions was much more manageable. The instruments gathering the data were simpler, the cameras were much lower resolution, and the missions didnt last as long (not counting the Viking missions.)

And though a system designed to find small craters on the surface of Mars might not capture the imagination of most people, its indicative of what the future will hold.

One day, more scientists will be freed from sitting for hours at a time going over images. Theyll be able to delegate some of that work to AI systems like COSMIC and its crater finder.

Well probably all benefit from that.

Like Loading...

Read more from the original source:
Machine Learning Software is Now Doing the Exhausting Task of Counting Craters On Mars - Universe Today

Why organisations are poised to embrace machine learning – IT Brief Australia

Article by Snowflake senior sales engineer Rishu Saxena.

Once a technical novelty seen only in software development labs or enormous organisations, machine learning (ML) is poised to become an important tool for large numbers of Australian and New Zealand businesses.

Lured by promises of improved productivity and faster workflows, companies are investing in the technology in rising numbers. According to research firm Fortune Business Insights, the ML market will be worth US$117.19 billion by 2027.

Historically, ML was perceived to be an expensive undertaking that required massive upfront investment in people, as well as both storage and compute systems. Recently, many of the roadblocks that had been hindering adoption have now been removed.

One such roadblock was not having the right mindset or strategy when undertaking ML-related projects. Unlike more traditional software development, ML requires a flexible and open-ended approach. Sometimes it wont be possible to assess the result accurately, and this could well change during deployment and preliminary use.

A second roadblock was the lack of ML automation tools available on the market. Thanks to large investments and hard work by computer scientists, the latest generation of auto ML tools are feature-rich, intuitive and affordable.

Those wanting to put them to work no longer have to undertake extensive data science training or have a software development background. Dubbed citizen data scientists, these people can readily experiment with the tools and put their ideas into action.

The way data is stored and accessed by ML tools has also changed. Advances in areas such as cloud-based data warehouses and data lakes means an organisation can now have all its data in a single location. This means the ML tools can scan vast amounts of data relatively easily, potentially leading to insights that previously would have gone unnoticed.

The lowering of storage costs has further assisted this trend. Where an organisation may have opted to delete or archive data onto tape, that data can now continue to be stored in a production environment, making it accessible to the ML tools.

For those organisations looking to embrace ML and experience the business benefits it can deliver, there are a series of steps that should be followed:

When starting with ML, dont try to run before you walk. Begin with small, stand-alone projects that give citizen data scientists a chance to become familiar with the machine learning process, the tools, how they operate, and what can be achieved. Once this has been bedded down, its then easier to gradually increase the size and scope of activities.

To start your ML journey, lean on the vast number of auto ML tools available on the market instead of using open source notebook based IDEs that require high levels of skills and familiarity with ML.

There is an increasing number of ML tools on the market, so take time to evaluate options and select the ones best suited to your business goals. This will also give citizen data scientists required experience before any in-house development is undertaken.

ML is not something that has to be the exclusive domain of the IT department. Encourage the growth of a pool of citizen data scientists within the organisation who can undertake projects and share their growing knowledge.

To enable ML tools to do as much as possible, centralise the storage of all data in your organisation. One option is to make use of a cloud-based data platform that can be readily scaled as data volumes increase.

Once projects have been underway for some time, closely monitor the results being achieved. This will help to guide further investments and shape the types of projects that will be completed in the future.

Once knowledge and experience levels within the organisation have increased, consider tackling more complex projects. These will have the potential to add further value to the organisation and ensure that stored data is generating maximum value.

The potential for ML to support organisations, help them to achieve fresh insights, and streamline their operations is vast. By starting small and growing over time, its possible to keep costs under control while achieving benefits in a relatively short space of time.

See the original post:
Why organisations are poised to embrace machine learning - IT Brief Australia

A machine learning approach to define antimalarial drug action from heterogeneous cell-based screens – Science Advances

Abstract

Drug resistance threatens the effective prevention and treatment of an ever-increasing range of human infections. This highlights an urgent need for new and improved drugs with novel mechanisms of action to avoid cross-resistance. Current cell-based drug screens are, however, restricted to binary live/dead readouts with no provision for mechanism of action prediction. Machine learning methods are increasingly being used to improve information extraction from imaging data. These methods, however, work poorly with heterogeneous cellular phenotypes and generally require time-consuming human-led training. We have developed a semi-supervised machine learning approach, combining human- and machine-labeled training data from mixed human malaria parasite cultures. Designed for high-throughput and high-resolution screening, our semi-supervised approach is robust to natural parasite morphological heterogeneity and correctly orders parasite developmental stages. Our approach also reproducibly detects and clusters drug-induced morphological outliers by mechanism of action, demonstrating the potential power of machine learning for accelerating cell-based drug discovery.

Cell-based screens have substantially advanced our ability to find new drugs (1). However, most screens are unable to predict the mechanism of action (MoA) of identified hits, necessitating years of follow-up after discovery. In addition, even the most complex screens frequently find hits against cellular processes that are already targeted (2). Limitations in finding new targets are becoming especially important in the face of rising antimicrobial resistance across bacterial and parasitic infections. This rise in resistance is driving increasing demand for screens that can intuitively find new antimicrobials with novel MoAs. Demand for innovation in drug discovery is exemplified in efforts on targeting Plasmodium falciparum, the parasite that causes malaria. Malaria continues to be a leading cause of childhood mortality, killing nearly half a million children each year (3). Drug resistance has emerged to every major antimalarial to date including rapidly emerging resistance to frontline artemisinin-based combination therapies (4). While there is a healthy pipeline of developmental antimalarials, many target common processes (5) and may therefore fail quickly because of prevalent cross-resistance. Thus, solutions are urgently sought for the rapid identification of new drugs that have a novel MoA at the time of discovery.

Parasite cell morphology within the human contains inherent MoA-predictive capacity. Intracellular parasite morphology can distinguish broad stages along the developmental continuum of the asexual parasite (responsible for all disease pathology). This developmental continuum includes early development (early and late ring form), feeding (trophozoite), genome replication or cell division (schizont), and extracellular emergence [merozoite; see (6) for definitions]. Hence, drugs targeting a particular stage should manifest a break in the continuum. Morphological variation in the parasite cell away from the continuum of typical development may also aid drug MoA prediction if higher information granularity can be generated during a cell-based screen. Innovations in automated fluorescence microscopy have markedly expanded available data content in cell imaging (7). By using multiple intracellular markers, an information-rich landscape can be generated from which morphology, and, potentially, drug MoA can be deduced. This increased data content is, however, currently inaccessible both computationally and because it requires manual expert-level analysis of cell morphology. Thus, efforts to use cell-based screens to find drugs and define their MoA in a time-efficient manner are still limited.

Machine learning (ML) methods offer a powerful alternative to manual image analysis, particularly deep neural networks (DNNs) that can learn to represent data succinctly. To date, supervised ML has been the most successful application for classifying imaging data, commonly based on binning inputs into discrete, human-defined outputs. Supervised methods using this approach have been applied to study mammalian cell morphologies (8, 9) and host-pathogen interactions (10). However, discrete outputs are poorly suited for capturing a continuum of morphological phenotypes, such as those that characterize either malaria parasite development or compound-induced outliers, since it is difficult or impossible to generate labels of all relevant morphologies a priori. A cell imaging approach is therefore needed that can function with minimal discrete human-derived training data before computationally defining a continuous analytical space, which mirrors the heterogeneous nature of biological space.

Here, we have created a semi-supervised model that discriminates diverse morphologies across the asexual life cycle continuum of the malaria parasite P. falciparum. By receiving input from a deep metric network (11) trained to represent similar consumer images as nearby points in a continuous coordinate space (an embedding), our DNN can successfully define unperturbed parasite development with a much finer information granularity than human labeling alone. The same DNN can quantify antimalarial drug effects both in terms of life cycle distribution changes [e.g., killing specific parasite stage(s) along the continuum] and morphological phenotypes or outliers not seen during normal asexual development. Combining life cycle and morphology embeddings enabled the DNN to group compounds by their MoA without directly training the model on these morphological outliers. This DNN analysis approach toward cell morphology therefore addresses the combined needs of high-throughput cell-based drug discovery that can rapidly find new hits and predict MoA at the time of identification.

Using ML, we set out to develop a high-throughput, cell-based drug screen that can define cell morphology and drug MoA from primary imaging data. From the outset, we sought to embrace asynchronous (mixed stage) asexual cultures of the human malaria parasite, P. falciparum, devising a semi-supervised DNN strategy that can analyze fluorescence microscopy images. The workflow is summarized in Fig. 1 (A to C).

(A) To ensure all life cycle stages were present during imaging and analysis, two transgenic malaria cultures, continuously expressing sfGFP, were combined (see Materials and Methods); these samples were incubated with or without drugs before being fixed and stained for automated multichannel high-resolution, high-throughput imaging. Resulting datasets (B) contained parasite nuclei (blue), cytoplasm (not shown), and mitochondrion (green) information, as well as the RBC plasma membrane (red) and brightfield (not shown). Here, canonical examples of a merozoite, ring, trophozoite, and schizont stage are shown. These images were processed for ML analysis (C) with parasites segregated from full field of views using the nuclear stain channel, before transformation into embedding vectors. Two networks were used; the first (green) was trained on canonical examples from human-labeled imaging data, providing MLderived labels (pseudolabels) to the second semi-supervised network (gray), which predicted life cycle stage and compound phenotype. Example images from human-labeled datasets (D) show that disagreement can occur between human labelers when categorizing parasite stages (s, schizont; t, trophozoite; r, ring; m, merozoite). Each thumbnail image shows (from top left, clockwise) merged channels, nucleus staining, cytoplasm, and mitochondria. Scale bar, 5 m.

The P. falciparum life cycle commences when free micron-sized parasites (called merozoites; Fig. 1B, far left) target and invade human RBCs. During the first 8 to 12 hours after invasion, the parasite is referred to as a ring, describing its diamond ringlike morphology (Fig. 1B, left). The parasite then feeds extensively (trophozoite stage; Fig. 1B, right), undergoing rounds of DNA replication and eventually divides into ~20 daughter cells (the schizont-stage; Fig. 1B, far right), which precedes merozoite release back into circulation (6). This discrete categorization belies a continuum of morphologies between the different stages.

The morphological continuum of asexual development represents a challenge when teaching ML models, as definitions of each stage will vary between experts (Fig. 1D and fig. S1). To embrace this, multiple human labels were collected. High-resolution three-dimensional (3D) images of a 3D7 parasite line continuously expressing superfolder green fluorescent protein (sfGFP) in the cytoplasm (3D7/sfGFP) were acquired using a widefield fluorescence microscope (see Materials and Methods), capturing brightfield DNA [4,6-diamidino-2-phenylindole (DAPI), cytoplasm (constitutively expressed sfGFP), mitochondria (MitoTracker abbreviated subsequently to MITO)], and the RBC membrane [fluorophore-conjugated wheat germ agglutinin (WGA)]. 3D datasets were converted to 2D images using maximum intensity projection. Brightfield was converted to 2D using both maximum and minimum projection, resulting in six channels of data for the ML. Labels (5382) were collected from human experts, populating the categories of ring, trophozoite, schizont, merozoite, cluster-of-merozoites (multiple extracellular merozoites attached after RBC rupture), or debris. For initial validation and as a test of reproducibility between experts, an additional 448 parasites were collected, each labeled by five experts (Fig. 1D).

As demonstrated (Fig. 1D and fig. S1A), human labelers show some disagreement, particularly between ring and trophozoite stages. This disagreement is to be expected, with mature ring stage and early trophozoite stage images challenging to define even for experts. When comparing the human majority vote versus the model classification (fig. S1B and note S1), some disagreement was seen, particularly for human-labeled trophozoites being categorized as ring stages by the ML algorithm.

Image patches containing parasites within the RBC or after merozoite release were transformed into input embeddings using the deep metric network architecture originally trained on consumer images (11) and previously shown for microscopy images (12). Embeddings are vectors of floating point numbers representing a position in high-dimensional space, trained so related objects are located closer together. For our purposes, each image channel was individually transformed into an embedding of 64 dimensions before being concatenated to yield one embedding of 384 dimensions per parasite image.

Embeddings generated from parasite images were next transformed using a two-stage workflow to represent either on-cycle (for mapping the parasite life cycle continuum) or off-cycle effects (for mapping morphology or drug induced outliers). Initially, an ensemble of fully connected two-layer DNN models was trained on the input embeddings to predict the categorical human life cycle labels for dimethyl sulfoxide (DMSO) controls. DMSO controls consisted of the vehicle liquid for drug treatments (DMSO) being added to wells containing no drugs. For consistency, the volume of DMSO was normalized in all wells to 0.5%. This training gave the DNN robustness to control for sample heterogeneity and, hence, sensitivity for identifying unexpected results (outliers). The ensemble was built from three pairs of fully supervised training conditions (six total models). Models only differed in the training data they received. Each network pair was trained on separate (nonoverlapping) parts of the training data, providing an unbiased estimate of the model prediction variance.

After initial training, the supervised DNN predicted its own labels (i.e., pseudolabels) for previously unlabeled examples. As with human-derived labels, DNN pseudolabeling was restricted to DMSO controls (with high confidence) to preserve the models sensitivity to off-cycle outliers (which would not properly fit into on-cycle outputs). High confidence was defined as images given the same label prediction from all six models and when all models were confident of their own prediction (defined as twice the probability of selecting the correct label at random). This baseline random probability is a fixed number for a dataset or classification and provided a suitable baseline for model performance.

A new ensemble of models was then trained using the combination of human-derived labels and DNN pseudolabels. The predictions from this new ensemble were averaged to create the semi-supervised model.

The semi-supervised model was first used to represent the normal (on-cycle) life cycle continuum. We selected the subset of dimensions in the unnormalized final prediction layer that corresponded to merozoites, rings, trophozoites, and schizonts. This was projected into 2D space using principal components analysis (PCA) and shifted such that its centroid was at the origin. This resulted in a continuous variable where angles represent life cycle stage progression, referred to as Angle-PCA. This Angle-PCA approach permitted the full life cycle to be observed as a continuum with example images despite data heterogeneity (Fig. 2A and fig. S2) and 2D projection (Fig. 2B) following the expected developmental order of parasite stages. This ordered continuum manifested itself without specific constraints being imposed, except those provided by the categorical labels from human experts (see note S2).

After learning from canonical human-labeled parasite images (for examples, please see Fig. 1B) and filtering debris and other outliers, the remaining life cycle data from asynchronous cultures was successfully ordered by the model. The parasites shown are randomly selected DMSO control parasites from multiple imaging runs, sorted by Angle PCA (A). The colored, merged images show RBC membrane (red), mitochondria (green), and nucleus (blue). For a subset of parasites on the right, the colored, merged image plus individual channels are shown: (i) merged, (ii) brightfield minimum projection, (iii) nucleus, (iv) cytoplasm, (v) mitochondria, and (vi) RBC membrane (brightfield maximum projection was also used in ML but is not shown here). The model sorts the parasites in life cycle stage order, despite heterogeneity of signal due to nuances such as imaging differences between batches. The order of the parasites within the continuum seen in (A) is calculated from the angle within the circle created by projecting model outputs using PCA, creating a 2D scatterplot (B). This represents a progression through the life cycle stages of the parasite, from individual merozoites (purple) to rings (yellow), trophozoites (green), schizonts (dark green), and finishing with a cluster of merozoites (blue). The precision-recall curve (C) shows that human labelers and the model have equivalent accuracy in determining the earlier/later parasite in pairs. The consensus of the human labelers was taken as ground truth, with individual labelers (orange) agreeing with the consensus on 89.5 to 95.8% of their answers. Sweeping through the range of too close to call values with the ML model yields the ML curve shown in black. Setting this threshold to 0.11 radians, the median angle variance across the individual models used in the ensemble yields the blue dot.

To validate the accuracy of the continuous life cycle prediction, pairs of images were shown to human labelers to define their developmental order (earlier/later) with the earliest definition being the merozoite stage. Image pairs assessed also included those considered indistinguishable (i.e., too close to call). Of the 295 pairs selected for labeling, 276 measured every possible pairing between 24 parasites, while the remaining 19 pairs were specifically selected to cross the trophozoite/schizont boundary. Human expert agreement with the majority consensus was between 89.5 and 95.8% (note S3), with parasite pairs called equal (too close to call) to 25.7 to 44.4% of the time. These paired human labels had more consensus than the categorical (merozoite, ring, trophozoite, and schizont) labels that had between 60.9 and 78.4% agreement between individual human labels and the majority consensus.

The Angle-PCA projection results provide an ordering along the life cycle continuum, allowing us to compare this sort order to that by human experts. With our ensemble of six models, we could also evaluate the consensus and variation between angle predictions for each example. The consensus between models for relative angle between two examples was greater than 96.6% (and an area under the precision-recall curve score of 0.989; see note S4 for definition), and the median angle variation across all labeled examples was 0.11 radians. The sensitivity of this measurement can be tuned by selecting a threshold for when two parasites are considered equal, resulting in a precision-recall curve (Fig. 2C). When we use the median angle variation of the model as the threshold for examples that are too close to call, we get performance (light blue point) that is representative of the human expert average. These results demonstrate that our semi-supervised model successfully identified and segregated asynchronous parasites and infected RBCs from images that contain >90% uninfected RBCs (i.e., <10% parasitaemia) and classifies parasite development logically along the P. falciparum asexual life cycle.

Having demonstrated the semi-supervised model can classify asynchronous life cycle progression consistently with fine granularity, the model was next applied to quantify on-cycle differences (i.e., life cycle stage-specific drug effects) in asynchronous, asexual cultures treated with known antimalarial drugs. Two drug treatments were initially chosen that give rise to aberrant cellular development: the ATP4ase inhibitor KAE609 (also called Cipargamin) (13) and the mitochondrial inhibiting combinational therapy of atovaquone and proguanil (14) (here referred to as Ato/Pro). KAE609 reportedly induces cell swelling (15), while Ato/Pro reduces mitochondrial membrane potential (16). Drug treatments were first tested at standard screening concentrations (2 M) for two incubation periods (6 and 24 hours). Next, drug dilutions were carried out to test the semi-supervised models sensitivity to lower concentrations using half-median inhibitory concentrations (IC50s) of each compound (table S1). IC50 and 2 M datasets were processed through the semi-supervised model and overlaid onto DMSO control data as a histogram to explore on-cycle drug effects (Fig. 3). KAE609 treatment exhibited a consistent skew toward ring stage parasite development (8 to 12 hours after RBC invasion; Fig. 3) without an increase within this stage of development, while the Ato/Pro treatment led to reduced trophozoite stages (~12 to 30 hours after RBC invasion; Fig. 3). This demonstrates that the fine-grained continuum has the sensitivity to detect whether drugs affect specific stages of the parasite life cycle.

Asynchronous Plasmodium falciparum cultures were treated with the ATPase4 inhibitor KAE609 or the combinational MITO treatment of atovaquone and proguanil (Ato/Pro) with samples fixed and imaged 6 (A) and 24 (B) hours after drug additions. Top panels show histograms indicating the number of parasites across life cycle continuum. Compared to DMSO controls (topmost black histogram), both treatments demonstrated reduced parasite numbers after 24 hours. Shown are four drug/concentration treatment conditions: low-dose Ato/Pro (yellow), high-dose Ato/Pro (orange), low-dose KAE609 (light blue), and high-dose KAE609 (dark blue). Box plots below demonstrate life cycle classifications in the DMSO condition of images from merozoites (purple) to rings (yellow), trophozoites (green), and finishing with schizonts (dark green).

The improved information granularity was extended to test whether the model could identify drug-based morphological phenotypes (off-cycle) toward determination of MoA. Selecting the penultimate 32-dimensional layer of the semi-supervised model meant that, unlike the Angle-PCA model, outputs were not restricted to discrete on-cycle labels but instead represented both on- and off-cycle changes. This 32-dimensional representation is referred to as the morphology embedding.

Parasites were treated with 1 of 11 different compounds, targeting either PfATP4ase (ATP4) or mitochondria (MITO) and DMSO controls (table S1). The semi-supervised model was used to evaluate three conditions: random, where compound labels were shuffled; Angle-PCA, where the two PCA coordinates are used; and full embedding, where the 32-dimensional embedding was combined with the Angle-PCA. To add statistical support that enables compound level evaluation, a bootstrapping of the analysis was performed, sampling a subpopulation of parasites 100 times.

As expected, the randomized labels led to low accuracy (Fig. 4A), serving as a baseline for the log odds (probability). When using the 2D Angle-PCA (on-cycle) information, there was a significant increase over random in the log odds ratio (Fig. 4A). This represents the upper-bound information limit for binary live/dead assays due to their insensitivity to parasite stages. When using the combined full embedding, there was a significant log odds ratio increase over both the random and Angle-PCA conditions (Fig. 4A). To validate that this improvement was not a consequence of having a larger dimensional space compared to the Angle-PCA, an equivalent embedding from the fully supervised model trained only on expert labels (and not on pseudolabels) demonstrated approximately the same accuracy and log odds ratio as Angle-PCA. Thus, our semi-supervised model can create an embedding sensitive to the phenotypic changes under distinct MoA compound treatment.

To better define drug effect on Plasmodium falciparum cultures, five mitochondrial (orange text) and five PfATP4ase (blue text) compounds were used; after a 24-hour incubation, images were collected and analyzed by the semi-supervised model. To test performance, various conditions were used (A). For random, images and drug names were scrambled, leading to the model incorrectly grouping compounds based on known MoA (B). Using life cycle stage definition (as with Fig. 3), the model generated improved grouping of compounds (C) versus random. Last, by combining the life cycle stage information with the penultimate layer (morphological information, before life cycle stage definition) of the model, it led to correct segregation of drugs based on their known MoA (D).

To better understand drug MoA, we evaluated how the various compounds were grouped together by the three approaches (random, Angle-PCA, and morphology embedding), performing a hierarchical linkage dendrogram (Fig. 4, B to D). The random approach shows that, as expected, the different compounds do not reveal MoA similarities. For the Angle-PCA output, the MITO inhibitors atovaquone and antimycin are grouped similarly, but the rest of the clusters are a mixture of compounds from the two MoA groups. Last, the morphology embedding gave rise to an accurate separation between the two groups of compounds having different MoA. One exception for grouping was atovaquone (when used alone), which was found to poorly cluster with either group (branching at the base of the dendrogram; Fig. 4D). This result is likely explained by the drug dosages used, as atovaquone is known to have a much enhanced potency when used in combination with proguanil (16).

The semi-supervised model was able to consistently cluster MITO inhibitors away from ATP4ase compounds in a dimensionality that suggested a common MoA. Our semi-supervised model can therefore successfully define drug efficacy in vitro and simultaneously assign a potential drug MoA from asynchronous (and heterogeneous) P. falciparum parasite cultures using an imaging-based screening assay with high-throughput capacity.

Driven by the need to accelerate novel antimalarial drug discovery with defined MoA from phenotypic screens, we applied ML to images of asynchronous P. falciparum cultures. This semi-supervised ensemble model could identify effective drugs and cluster them according to MoA, based on life cycle stage (on-cycle) and morphological outliers (off-cycle).

Recent image-based ML approaches have been applied to malaria cultures but have, however, focused on automated diagnosis of gross parasite morphologies from either Giemsa- or Leishman-stained samples (1719), rather than phenotypic screening for drug MoA. ML of fluorescence microscopy images have reported malaria identification of patient-derived blood smears (20) and the use of nuclear and mitochondrial specific dyes for stage categorization and viability (21), although the algorithmic approach did not include deep learning. Previous unsupervised and semi-supervised ML approaches have been applied to identify phenotypic similarities in other biological systems, such as cancer cells (12, 2224), but none have addressed the challenge of capturing the continuum of biology within the heterogeneity of control conditions. We therefore believe our study represents a key milestone in the use of high-resolution imaging data beyond diagnostics to predict the life cycle continuum of a cell type (coping with biological heterogeneity), as well as using this information to indicate drug-induced outliers and successfully group these toward drug MoA.

Through semi-supervised learning, only a small number of human-derived discrete but noisy labels from asynchronous control cultures were required for our DNN method to learn and distribute data as a continuous variable, with images following the correct developmental order. By reducing expert human input, which can lead to image identification bias (see note S2), this approach can control for interexpert disagreement and is more time efficient. This semi-supervised DNN therefore extends the classification parameters beyond human-based outputs, leading to finer information granularity learned from the data automatically through pseudolabels. This improved information, derived from high-resolution microscopy data, permits the inclusion of subtle but important features to distinguish parasite stages and phenotypes that would otherwise be unavailable.

Our single model approach was trained on life cycle stages through embedding vectors, whose distribution allows identification of two readouts, on-cycle (sensitive to treatments that slow the life cycle or kill a specific parasite stage) and off-cycle (sensitive to treatments that cluster away from control distributions). We show that this approach with embeddings was sensitive to stage-specific effects at IC50 drug concentrations (Fig. 3), much lower than standard screening assays. Drug-based outliers were grouped in a MoA-dependent manner (Fig. 4), with data from similar compounds grouped closer than data with unrelated mechanisms.

The simplicity of fluorescence imaging means that this method could be applied to different subcellular parasite features, potentially improving discrimination of cultures treated with other compounds. In addition, imaging the sexual (gametocyte) parasite stages with and without compound treatments will build on the increasing need for drugs, which target multiple stages of the parasite life cycle (25). Current efforts to find drugs targeting the sexual stages of development are hampered by the challenges of defining MoA from a nonreplicating parasite life cycle stage (25). This demonstrates the potential power of a MoA approach, applied from the outset of their discovery, simply based on cell morphology.

In the future, we envisage that on-cycle effects could elucidate the power of combinational treatments (distinguishing treatments targeting different life cycle stages) for a more complete therapy. Using off-cycle, this approach could identify previously unidentified combinational treatments based on MoA. Because of the sample preparation simplicity, this approach is also compatible with using drug-resistant parasite lines.

New drugs against malaria are seen as a key component of innovation required to bend the curve toward the diseases eradication or risk a return to premillennium rates (3, 26). Seen in this light, application of ML-driven screens should enable the rapid, large-scale screening and identification of drugs with concurrent determination of predicted MoA. Since ML-identified drugs will start from the advanced stage of predicted MoA, these should bolster the much-needed development of new chemotherapeutics for the fight against malaria.

To generate parasite line 3D7/sfGFP, 3D7 ring stages were transfected with both plasmids pkiwi003 (p230p-bsfGFP) and pDC2-cam-co.Cas9-U6.2-hDHFR _P230p (50 g each; fig. S3) following standard procedures (27) and selected on 4 nM WR99210 (WR) for 10 days. pDC2-cam-co.Cas9-U6.2-hDHFR _P230p encodes for Cas9 and the guide RNA for the P230p locus. pkiwi003 comprises the repair sequence to integrate into the P230p locus after successful double-strand break induced by the Cas9. pkiwi003 (p230p-bsfGFP) was obtained by inserting two polymerase chain reaction (PCR) fragments both encoding parts of P230p (PF3D7_0208900) consecutively into the pBluescript SK() vector with Xho I/Hind III and Not I/Sac I, respectively. sfGFP together with the hsp70 (bip) 5 untranslated region was PCR-amplified from pkiwi002 and cloned into pkiwi003 with Hind III/Not I. pkiwi002 is based on pBSp230pDiCre (28), where the FRB (binding domain of the FKBP12rapamycin-associated protein) and Cre60 cassette (including promoter and terminator) was removed with Afe I/Spe I, and the following linkers inserted are as follows: L1_F cctttttgcccccagcgctatataactagtACAAAAAAGTATCAAG and L1_R CTTGATACTTTTTTGTactagttatatagcgctgggggcaaaaagg. In a second step, FKBP (the immunophilin FK506-binding protein) and Cre59 were removed with Nhe I/Pst I and replaced by sfGFP, which was PCR-amplified from pCK301 (29). pDC2-cam-co.Cas9-U6.2-hDHFR _P230p was obtained by inserting the guide RNA (AGGCTGATGAAGACATCGGG) into pDC2-cam-co.Cas9-U6.2-hDHFR (30) with Bbs I. Integration of pkiwi003 into the P230p locus was confirmed by PCR using primers #99 (ACCATCAACATTATCGTCAG), #98 (TCTTCATCAGCCTGGTAAC), and #56 (CATTTACACATAAATGTCACAC; fig. S3).

The transgenic 3D7/sfGFP P. falciparum asexual parasites were cultured at 37C (with a gas mixture of 90% N2, 5% O2, and 5% CO2) in human O+ erythrocytes under standard conditions (31), with RMPI-Hepes medium supplemented with 0.5% AlbuMAX-II. Two independent stocks (culture 1 and culture 2; Fig. 1A) of 3D7/sfGFP parasites were maintained in culture and synchronized separately with 5% d-sorbitol on consecutive days to ensure acquisition of all stages of the asexual cycle on the day of sample preparation. Samples used for imaging derived from cultures harboring an approximate 1:1:1 ratio of rings, trophozoites, and schizonts, with a parasitaemia around 10%.

Asexual cultures were diluted 50:50 in fresh media before 50 nM MitoTracker CMXRos (Thermo Fisher Scientific) was added for 20 min at 37C. Samples were then fixed in phosphate-buffered saline (PBS) containing 4% formaldehyde and 0.25% glutaraldehyde and placed on a roller at room temperature, protected from light for 20 min. The sample was then washed 3 in PBS before 10 nM DAPI, and WGA (5 g/ml) conjugated to Alexa Fluor 633 was added for 10 min and protected from light. The sample was then washed 1 in PBS and diluted 1:30 in PBS before pipetting 100 l into each well of a CellVis (Mountain View, CA) 96-well plate.

Samples were imaged using a Nikon Ti-Eclipse widefield microscope and Hamamatsu electron multiplying charge-coupled device camera, with a 100 Plan Apo 1.4 numerical aperture (NA) oil objective lens (Nikon); the NIS-Elements JOBS software package (Nikon) was used to automate the plate-based imaging. The five channels [brightfield, DNA (DAPI), cytoplasm (sfGFP-labeled), mitochondria (MitoTracker or MITO), and RBC (WGA-633)] were collected serially at Nyquist sampling as a 6-m z-stack, with fluorescent excitation from the CoolLED light source. To collect enough parasite numbers per treatment, 32 fields of view (sites) were randomly generated and collected within each well, with treatments run in technical triplicate. Data were saved directly onto an external hard drive for short-term storage and processing (see below).

The 3D images were processed via a custom macro using ImageJ and transformed into 2D maximum intensity projection images. Brightfield channels were also projected using the minimum intensity projection as this was found to improve analysis of the food vacuole and anomalies including double infections. Converting each whole-site image to per-parasite embedding vectors was performed as previously described (12), with some modifications: The Otsu threshold was set to the minimum of the calculated threshold or 1.25 of the foreground mean of the image, and centers closer than 100 pixels were pruned. Each channel image was separately fed as a grayscale image into the deep metric network for conversion into a 64-dimension embedding vector. The six embedding vectors (one from each fluorescent channel and both minimum and maximum projections of the brightfield channel) were concatenated to yield a final 384 dimension embedding vector.

All labels were collected using the annotation tool originally built for collecting diabetic retinopathy labels (32). For each set of labels gathered, tiled images were stitched together to create a collage for all parasites to be labeled. These collages contained both stains in grayscale and color overlays to aid identification. Collages and a set of associated questions were uploaded to the annotation tool, and human experts (Imperial College London) provided labels (answers). In cases where multiple experts labeled the same image, a majority vote was used to determine the final label.

Initial labels for training classified parasites into 1 of 11 classes: merozoite, ring, trophozoite, schizont, cluster of merozoites, multiple infection, bad image, bad patch (region of interest) location, parasite debris, unknown parasite inside an RBC, or other. Subsequent labels were collected with parasite debris classified further into the following: small debris remnant, cluster of debris, and death inside a RBC (table S2). For training, the following labels were dropped: bad image, bad patch location, unknown parasite inside an RBC, unspecified parasite debris, and other. For these labels, five parasites were randomly sampled from each well of experiments.

To validate the model performance, an additional 448 parasites were labeled by five experts. The parasites were selected from eight separate experimental plates using only control image data (DMSO only).

Last, paired labels were collected to validate the sort-order results. For these labels, the collage included two parasites, and experts identified which parasite was earlier in the life cycle or whether the parasites were too close to call. Here, data from the 448 parasite validation set were used, limited to cases where all experts agreed that the images were of a parasite inside an RBC. From this set, 24 parasites were selected, and all possible pairings of these 24 parasites were uploaded as questions (24 choose 2 = 276 questions uploaded). In addition, another 19 pairs were selected that were near the trophozoite/schizont boundary to enable angle resolution analysis.

To prepare the data for analysis, the patch embeddings were first joined with the ground truth labels for patches with labels. Six separate models were trained on embeddings to classify asexual life cycle stages and normal anomalies such as multiple infection, cell death, and cellular debris. Each model was a two-layered (64 and 32 dimensions), fully connected (with ReLu nonlinearities) neural network. To create training data for each of the six models, human-labeled examples were partitioned so that each example within a class is randomly assigned to one of four partitions. Each partition is a split of the data with example images randomly placed into a partition (subject to the constraint that it is balanced for each life cycle category). Each model was then trained on one of the six ways to select a pair from the four partitions. Training was carried out with a batch size of 128 for 1000 steps using the Adam optimizer (33) with a learning rate of 2 104. Following the initial training, labels were predicted on all unlabeled data using all six models, and for each class, 400 examples were selected with the highest mean probability (and at least a mean probability of 0.4) and with an SD of the probability less than 0.07 (which encompasses the majority of the predictions with labels). The training procedure was repeated with the original human labels and predicted (pseudo-) labels to generate our final model. The logits are extracted from the trained model, and a subspace representing the normal life cycle stages is projected using 2D by PCA. The life cycle angle is computed as arctan(y/x), where x and are the first and second coordinates of the projection, respectively.

For each drug with a certain dose and application duration, the evaluation of its effect is based on the histogram of the classified asexual life cycle stages, and finer binned stages obtained from the estimated life cycle angle. A breakdown of labeled images for drug morphologies is given in table S3.

WHO, World Malaria Report (Geneva, 2019).

J. Wang, Y. Song, T. Leung, C. Rosenberg, J. Wang, J. Philbin, B. Chen, Y. Wu, Learning Fine-Grained Image Similarity with Deep Ranking, paper presented at the Proceedings of the 2014 IEEE Conference on Computer Vision and Pattern Recognition (IEEE, 2014), pp. 13861393.

Read more here:
A machine learning approach to define antimalarial drug action from heterogeneous cell-based screens - Science Advances

Four steps to accelerate the journey to machine learning – SiliconANGLE News

This is the golden age of machine learning. Once considered peripheral, machine learning technology is becoming a core part of businesses around the world. From healthcare to agriculture, fintech to media and entertainment, machine learning holds great promise for industries universally.

Although standing up machine learning projects can seem daunting, ingraining a machine learning-forward mindset within the workplace is critical. In 2018, according to Deloitte Insights State of AI in Enterprise report, 63% of companies invested in machine learning to catch up with their rivals or to narrow their lead. International Data Corp. estimates that by 2021, global spending on AI and other cognitive technologies will exceed $50 billion.

So, the question is no longer whether your company should have a machine learning strategy, but rather, how can your company get its machine learning strategy in motion as quickly and effectively as possible?

Whether your company is just getting started with machine learning, or in the middle of your first implementation, here are the four steps that you should take in order to have a successful journey.

When it comes to adopting machine learning, data is often cited as the No. 1 challenge. In our experience with customers, more than half of the time building machine learning models can be spent in data wrangling, data cleanup and pre-processing stages. If you dont invest in establishing a strong data strategy, any machine learning talent you hire will be forced to spend a significant proportion of their time dealing with data cleanup and management, instead of inventing new algorithms.

When starting out, the three most important questions to ask are: What data is available today? What data can be made available? And a year from now, what data will we wish we had started collecting today?

In order to determine what data is available today, youll need to overcome data hugging, the tendency for teams to guard the data they work with most closely and not share with other groups in the organization. Breaking down silos between teams for a more expansive view of the data landscape is crucial for long-term success. And along the way, youll need to make sure you have the right access control and data governance.

On top of that, youll need to know what data actually matters as part of your machine learning approach. When you plan your data strategy, think about best ways to store data and invest early in the data processing tools for de-identification and anonymization if needed. For example, Cerner Corp. needed to tackle this challenge to effectively leverage their data for predictive and digital diagnostic insights. Today, the company uses a fully managed service to build, deploy and manage machine learning models at scale.

When evaluating what and how to apply machine learning, you should focus on assessing the problem across three dimensions: data readiness, business impact and machine learning applicability the chance of success based on your teams skills.

Balancing speed with business value is key. You should first look for places where you already have a lot of untapped data. Next, evaluate if the area will benefit from machine learning or if youre fixing something that isnt actually broken. Avoid picking a problem thats flashy but has unclear business value, as it will end up becoming a one-off experiment that never sees the light of day.

A good example of solving for the right problems can be seen in Formula One World Championship Ltd. The motorsport company was looking for new ways to deliver race metrics that could change the way fans and teams experience racing, but had more than 65 years of historical race data to sift through.After aligning their technical and domain experts to determine what type of untapped data had the most potential to deliver value for its teams and fans, Formula 1 data scientists then used Amazon SageMaker to train deep learning modelson this historical data to extract critical performance statistics, make race predictions and relay engaging insights to their fans into the split-second decisions and strategies adopted by teams and drivers.

Next, in order to move from a few pilots to scaling machine learning, you need to champion a culture of machine learning. Leaders and developers alike should always be thinking about how they can apply machine learning across various business problems.

A common mistake a lot of companies make is putting tech experts on a separate team. By working in a silo, they may end up building machine learning models mostly as proof of concepts, but dont actually solve real business problems. Instead, businesses need to combine a blend of technical and domain experts to work backwards from the customer problem. Assembling the right group of people also helps eliminate the cultural barrier to adoption with a quicker buy-in from the business.

Similarly, leaders should constantly find ways to make it easier for their developers to apply machine learning. Building the infrastructure to do machine learning at scale is a labor-intensive process that slows down innovation. They should encourage their teams not to focus on the undifferentiated heavy lifting portions of building machine learning models. By using tools that cover the entire machine learning workflow to build, train and deploy machine learning models, companies can get to production faster with much less effort and at a lower cost.

For instance, Intuit Inc. wanted to simplify the expense sorting process for their self-employed TurboTax customers to help identify potential deductions. Using Amazon SageMaker for its ExpenseFinder tool, which automatically pulls a years worth of bank transactions, Intuits machine learning algorithm helps its customers discover $4,300 on average in business expenses. Intuits time to build machine learning models also decreased from six months to less than a week.

Finally, to build a successful machine learning culture, you need to focus on developing your team. This includes building the right skills for your engineers and ensuring that your line of business leaders are also getting the training needed to understand machine learning.

Recruiting highly experienced talent in an already limited field is highly competitive and often too expensive, so companies are well-served to develop internal talent as well. You can cultivate your developers machine learning skills through robust internal training programs, which also help attract and retain talent.

One approach used by Morningstar Inc., the global financial services firm, used hands-on training for employees with AWS DeepRacer to accelerate the application of machine learning across the companys investing products, services and processes. More than 445 of Morningstars employees are currently involved in the AWS DeepRacer League, which has created an engaging way to upskill and unite its global teams.

If your organization follows these steps, the machine learning culture you build will play a vital role in setting it up for long-term success. There will be growing pains, but at its core, machine learning is experimentation that gets better over time, so your organization must also embrace failures and take a long-term view of whats possible.

No longer an aspirational technology for fringe use cases, machine learning is making meaningful transformation possible for organizations around the world and can make a tangible impact on yours too.

Swami Sivasubramanian is vice president of Amazon AI, running AI and machine learning services for Amazon Web Services Inc. He wrote this article for SiliconANGLE.

Show your support for our mission with our one-click subscription to our YouTube channel (below). The more subscribers we have, the more YouTube will suggest relevant enterprise and emerging technology content to you. Thanks!

Support our mission: >>>>>> SUBSCRIBE NOW >>>>>> to our YouTube channel.

Wed also like to tell you about our mission and how you can help us fulfill it. SiliconANGLE Media Inc.s business model is based on the intrinsic value of the content, not advertising. Unlike many online publications, we dont have a paywall or run banner advertising, because we want to keep our journalism open, without influence or the need to chase traffic.The journalism, reporting and commentary onSiliconANGLE along with live, unscripted video from our Silicon Valley studio and globe-trotting video teams attheCUBE take a lot of hard work, time and money. Keeping the quality high requires the support of sponsors who are aligned with our vision of ad-free journalism content.

If you like the reporting, video interviews and other ad-free content here,please take a moment to check out a sample of the video content supported by our sponsors,tweet your support, and keep coming back toSiliconANGLE.

Go here to see the original:
Four steps to accelerate the journey to machine learning - SiliconANGLE News

Global Machine Learning Market To Touch Highest Milestone In Terms of Overall Growth By 2026 – The Daily Chronicle

TheGlobal Machine Learning Market To Amass Huge Proceeds During Estimated TimelineA fundamental outline of theMachine Learningniche is presented by the Machine Learning report that entails definitions, classifications, applications together with industry chain framework. TheMachine Learningreport provides a far-reaching evaluation of necessary market dynamics and the latest trends. It also highlights the regional market, the prominent market players, as well as several market segments [Product, Applications, End-Users, and Major Regions], and sub-segments with a wide-ranging consideration of numerous divisions with their applications.

Request Free Sample Report of Machine Learning Report @https://www.zionmarketresearch.com/sample/machine-learning-market

Our Free Complimentary Sample Report Accommodate a Brief Introduction of the research report, TOC, List of Tables and Figures, Competitive Landscape and Geographic Segmentation, Innovation and Future Developments Based on Research Methodology.

Some of the Major Market Players Are:

International Business Machines Corporation, Microsoft Corporation, Amazon Web ServicesInc., BigmlInc., Google Inc., Hewlett Packard Enterprise Development Lp, Intel Corporation, and others.

Further, the report acknowledges that in these growing and promptly enhancing market circumstances, the most recent advertising and marketing details are very important to determine the performance in the forecast period and make essential choices for profitability and growth of the Machine Learning. In addition, the report encompasses an array of factors that impact the growth of the Machine Learning in the forecast period. Further, this specific analysis also determines the impact on the individual segments of the market.

Note In order to provide more accurate market forecast, all our reports will be updated before delivery by considering the impact of COVID-19.

(*If you have any special requirements, please let us know and we will offer you the report as you want.)

Furthermore, the study assessed major market elements, covering the cost, capacity utilization rate, growth rate, capacity, production, gross, usage, revenue, export, supply, price, market share, gross margin, import, and demand. In addition, the study offers a thorough segmentation of the global Machine Learning on the basis of geography [ Latin America, North America, Asia Pacific, Middle & East Africa, and Europe] , technology, end-users, applications, and region.

Download Free PDF Report Brochure@https://www.zionmarketresearch.com/requestbrochure/machine-learning-market

The Machine Learning report is a collection of pragmatic information, quantitative and qualitative estimation by industry experts, the contribution from industry connoisseurs and industry accomplices across the value chain. Furthermore, the report also provides the qualitative results of diverse market factors on its geographies and segments.

The Machine Learning report is an appropriate compilation of all necessary data for the residential, industrial. & commercials buyers, manufacturers, governments, and other stakeholders to implement their market-centric tactics in line with the projected as well as the prevailing trends in the Machine Learning. Apart from this, the report also provides insightful particulars of the existing policies, laws, together with guidelines.

Inquire more about this report @https://www.zionmarketresearch.com/inquiry/machine-learning-market

Promising Regions & Countries Mentioned In The Machine Learning Report:

Chapters Covered in Research Report are :

Chapter 1,2 :The goal of global Machine Learning covering the market introduction, product image, market summary and development scope.

Chapter 3, 4 :Global Market Competitions by Manufacturers, Sales Volume and Market Profit.

Chapter 5,6,7:Global Supply (Production), Consumption, Export, Import by Regions like United States, Asia-Pacific, China, India, Japan. Conducts the region-wise study of the market based on the sales ratio in each region, and market share from 2015 to 2024

Chapter 8,9,10:Global Market Analysis by Application, Cost Analysis, Marketing Strategy Analysis, Distributors/Traders

Chapter 11,12 :Market information and study conclusions, appendix and data sources.

The market report also identifies further useful and usable information about the industry mainly includes Machine Learning development trend analysis, investment return and feasibility analysis. Further, SWOT analysis is deployed in the report to analyze the key global market players growth in the Machine Learning industry

Purposes Behind Buying Machine Learning Report:-

Key questions answered in this comprehensive study Global Machine Learning Size, Status and Forecast 2026

Request the coronavirus impact analysis across industries and market

To view TOC of this report is available upon request@https://www.zionmarketresearch.com/toc/machine-learning-market

Also, Research Report Examines:

Thanks for reading this article; you can also get individual chapter wise section or region wise report version like North America, Europe or Asia.

Originally posted here:
Global Machine Learning Market To Touch Highest Milestone In Terms of Overall Growth By 2026 - The Daily Chronicle

Transforming customer banking experiences with AI and machine learning – Information Age

Mark Crichton, senior director of security product management at OneSpan, discusses how to transform customer banking experiences using AI and machine learning

How can customers be protected without experience getting compromised?

AI and machine learning have been driving significant transformations across virtually all industries over the last few years. By taking advantage of the technology, businesses can make sense of vast amounts of data to drive intelligent decision making and create new, innovative services to improve customer experiences. The banking sector in particular has benefited from AI and machine learning, especially when it comes to fighting fraud, which is a continuous, ever-changing threat that banks need to remain vigilant to.

At the same time, AI and machine learning powered technologies also ensure that security infrastructure doesnt compromise on the customer experience. For example, consumers want to stay safe, without having to deal with unnecessary false positives or blocked transactions. Any friction points throughout the customer journey can cause frustration, and force customers into looking at competitors.

Here, we look at the different ways banks can take advantage of AI and machine learning to keep customers secure, while maintaining an exceptional customer experience.

One of the main strengths of AI and machine learning algorithms is their ability to process vast amounts of data in real-time. The algorithms in use today take into account hundreds of factors, such as the device used, transaction history, the customers location and other contextual data to build up a detailed picture of each transaction and analyse the risk of that transaction within the context of the user and organisation.

We explore how artificial intelligence (AI) and machine learning (ML) can be incorporated into cyber security. Read here

As such, this risk-based approach is able to detect complex patterns in vast pools of structured and unstructured data, making AI-powered tools significantly quicker than humans at detecting new and emerging security threats, be that a spike in traffic from an unusual source, or a suspicious transaction that may require additional authentication.

For example, if a customer wants to check their bank balance from a recognised device and location, they would only need to go through basic authentication requirements to gain access to their account, such as entering a PIN. For higher-risk activity that fall outside of normal behaviour, such as an unusually large transaction amount in a new location, additional authentication will be required, for example a fingerprint or facial recognition.

Furthermore, because AI and machine learning algorithms are capable of analysing much larger data points, connections between entities and fraud patterns, the prevalence of false positives can be drastically reduced. This means fewer customers will be falsely rejected for fraud concerns, in turn minimising the labour and time costs associated with allocating staff to review flagged transactions.

So, by using AI, banks can analyse in real-time a wealth of information from several different data sources and channels, allowing them to make critical security decisions almost instantaneously and prevent fraud, without compromising on the customer experience.

Another example of how AI can be used by banks enhance both security and customer experience is with identity verification.

Banks have long relied on legacy, manual methods of verifying a customers identity, such as asking them to come into branch with their ID. As digital banking continues to boom, and data breaches expose more personal information across the web, it becomes more challenging to securely identify users without compromising the experience of the customer.

Information Age spoke to Juliette French, the engineering lead for IT and head of core platforms at Lloyds Banking Group, about how to run a successful IT team in the banking sector. Read here

By combining legacy identity verification methods with AI and machine learning techniques, banks can achieve extensive, context-aware identity verification, preventing identity fraud and allowing customers to open bank accounts or take out new products without needing to come into branch. This includes a number of checks such as ID document capture, cross-referencing biometric data such as a selfie with an ID, device location, real-time account checking, and more.

Its clear that advances in AI and machine learning have been instrumental in enhancing security for consumers, enabling new services, and enhancing the user experience. However, we also know that AI and machine learning on its own will not be enough to prevent cyber attacks on the banking sector now, or in the future.

Cyber criminals are always on the look out for new vulnerabilities they can exploit that will give them the greatest return-on-investment. Its no surprise to see attacks increase in both online and mobile channels, particularly as remote banking grows in popularity.

Banks and financial institutions need to be particularly vigilant when operating in new channels, or offering new products, that security is built in from the start and not added as an after-thought.

Go here to see the original:
Transforming customer banking experiences with AI and machine learning - Information Age

Understand Machine Learning and Data Analysis With The Help Of This Expert-Led Training – ExtremeTech

This site may earn affiliate commissions from the links on this page. Terms of use.

This week in machine learning news, artificial intelligence iswriting news with real style and awareness of prose. Its also helpingpredict incidents of lead exposure. And get thisAI is evencreating synthetic datafor use in place of the real data thats usually used to reach machine learning conclusions.

Just think about the implications of that one for a second.

No matter whether that fills you with amazement or fear, theres no argument that the impact of deep learning is staggering. And for a technology with the ability to revolutionize literally every facet of life on Earth, there are some equally staggering opportunities for those who understand it all.The Deep Learning and Data Analysis Certification Bundle ($39.99, 90 percent off)can help make you one of those enlightened and highly employable few.

This package brings together eight courses that explain how data analysis, visualizations, statistics, deep learning, and more really work.

For any hope to really internalize information this complex, you need an instructor with an absolute command of their subject and Minerva Singh knows her stuff. A seasoned data scientist, with a PhD from Cambridge and another degree from Oxford, Singh has spent years analyzing data and applying those findings to the creation of neural networks, artificial intelligence and machine learning.

Now, Singh is opening up all that experience to eager deep learning students with these courses that dont just examine how machines think, but also make those explanations understandable to new learners.

Beginning withData Analysis Masterclass With Statistics and Machine Learning In R, students are off and running, confronting easy-to-understand, hands-on examples of R programming and its place in the fabric of data science.

From there, the exploration continues as training covers topics like organizing large data sets, producing powerful visualizations and reports, making business forecasting related decisions, and understanding and working with various types of manufactured neural networks.

Singh is also a big advocate for free data analysis tools, so this package is often centered around accessible tools as opposed to proprietary apps that can cost big money. Students here learn to use tools like Karas, OpenCV and PyTorch, which can help you create your neural networks from scratch.

This world-shaping and career-changing technology training regularly sells for about $1,600, but in this collection, youll get everything you need forabout $5 per course, just $39.99.

Note: Terms and conditions apply. See the relevant retail sites for more information. For more great deals, go to our partners atTechBargains.com.

Now read:

Read the original here:
Understand Machine Learning and Data Analysis With The Help Of This Expert-Led Training - ExtremeTech

How Parkland Leverages Machine Learning, Geospatial Analytics to Reduce COVID-19 Exposure in Dallas – HIT Consultant

What You Should Know:

How Parkland Center for Clinical Innovation developed a machine learning-driven predictive model called the COVID-19 Proximity Index for Parkland Hospital in Dallas.

This program helps frontline workers to quickly identify which identify patients at the highest risk of exposure to COVID-19 by using geospatial analytics.

In addition, the program helps triage patients whileimproving the health and safety of hospital workers as well as the friends andfamilies of those exposed to COVID-19.

Since the earliestdays of the COVID-19pandemic, one of the biggest challenges for health systems has been to gainan understanding of the community spread of this virus and to determine howlikely is it that a person walking through the doors of a facility is at ahigher risk of being COVID-19 positive.

Without adequate access to testing data, health systems early-on were often forced to rely on individuals to answer questions such as whether they had traveled to certain high-risk regions. Even that unreliable method of assessing risk started becoming meaningless as local community spread took hold.

Parkland Health & Hospital System (the safety-net health system for Dallas County, TX) and PCCI (a Dallas, TX-based non-profit with expertise in the practical applications of advanced data science and social determinants of health) had a better idea. Community spread of an infectious disease is made possible through physical proximity and density of active carriers and non-infected individuals. Thus, to understand the risk of an individual contracting the disease (exposure risk), it was necessary to assess their proximity to confirmed COVID-19 cases based on their address and population density of those locations. If an exposure risk index could be created, then Parkland could use it to minimize exposure for their patients and health workers and provide targeted educational outreach in highly vulnerable zip codes.

PCCIs data science and the clinical team worked diligently in collaboration with the Parkland Informatics team to develop an innovative machine learning-driven predictive model called Proximity Index. Proximity Index predicts for an individuals COVID-19 exposure risk, based on their proximity to test positive casesandthe population density. This model was put into action at Parkland through PCCIs cloud-based advanced analytics and machine learning platform called Isthmus. PCCIs machine learning engineering team generated geospatial analysis for the model and, with support from the Parkland IT team, integrated it with their Electronic Health Record system.

Since April 22,Parklands population health team has utilized the Proximity Index for four keysystem-wide initiatives to triage more than 100,000 patient encounters and toassess needs, proactively:

1. Patients most at risk, with appointments in 1-2 days, were screened ahead of their visit to prevent spread within the hospital

2. Patients identified as vulnerable were offered additional medical (i.e. virtual visit, medication refill assistance) and social support

3. Communities, by zip-code, most at-risk were sent targeted messaging and focused outreach on COVID-19 prevention, staying safe, monitoring for symptoms, and resources for where to get tested and medical help.

4. High exposure risk patients who had an appointment at one of Parklands community clinics in the next couple of days were offered a telehealth appointment instead of a physical appointment if that was appropriate based on the type of appointment

In the future, PCCI is planning on offering Proximity Index to other organizations in the community schools, employers, etc., as well as to individuals to provide them with a data-driven tool to help in decision making around reopening the economy and society in a safe, thoughtful manner.

Many teams across the Parkland family collaborated on this project, including the IT team led by Brett Moran, MD, Senior Vice President, Associate Chief Medical Officer, and Chief Medical Information Officer at Parkland Health and Hospital System.

About the ManjulaJulka and Albert Karam

Manjula Julka, MD, FAAFP, MBA,is the Vice President of Clinical Innovation at PCCI. She brings more than 15years of experience in healthcare delivery transformation, leading a strong andconsistent track record of enabling meaningful outcomes.

Albert Karamis a data scientist at PCCI with experience building predictive models in healthcare. While working at PCCI, Albert has researched, identified, managed, modeled, and deployed predictive models for Parkland Hospital and the Parkland Community Health Plan. He is diverse in understanding modeling workflows and the implementation of real-time models.

See original here:
How Parkland Leverages Machine Learning, Geospatial Analytics to Reduce COVID-19 Exposure in Dallas - HIT Consultant

Comprehensive Report on Machine Learning as a Service Market Set to Witness Huge Growth by 2026 | Microsoft, International Business Machine, Amazon…

Machine Learning as a Service Marketresearch report is the new statistical data source added byA2Z Market Research. It uses several approaches for analyzing the data of target market such as primary and secondary research methodologies. It includes investigations based on historical records, current statistics, and futuristic developments.

The report gives a thorough overview of the present growth dynamics of the global Machine Learning as a Service with the help of vast market data covering all important aspects and market segments. The report gives a birds eye view of the past and present trends as well the factors expected to drive or impede the market growth prospects of the Machine Learning as a Service market in the near future.

Get Sample PDF Copy (Including FULL TOC, Graphs and Tables) of this report @:

https://www.a2zmarketresearch.com/sample?reportId=64929

Machine Learning as a Service Market is growing at a High CAGR during the forecast period 2020-2026. The increasing interest of the individuals in this industry is that the major reason for the expansion of this market.

Top Key Players Profiled in this report are:

Microsoft, International Business Machine, Amazon Web Services, Google, Bigml, Fico, Hewlett-Packard Enterprise Development, At&T.

The key questions answered in this report:

Various factors are responsible for the markets growth trajectory, which are studied at length in the report. In addition, the report lists down the restraints that are posing threat to the global Machine Learning as a Service market. It also gauges the bargaining power of suppliers and buyers, threat from new entrants and product substitute, and the degree of competition prevailing in the market. The influence of the latest government guidelines is also analyzed in detail in the report. It studies the Machine Learning as a Service markets trajectory between forecast periods.

Get up to 20% Discount on this Premium Report @:

https://www.a2zmarketresearch.com/discount?reportId=64929

The cost analysis of the Global Machine Learning as a Service Market has been performed while keeping in view manufacturing expenses, labor cost, and raw materials and their market concentration rate, suppliers, and price trend. Other factors such as Supply chain, downstream buyers, and sourcing strategy have been assessed to provide a complete and in-depth view of the market. Buyers of the report will also be exposed to a study on market positioning with factors such as target client, brand strategy, and price strategy taken into consideration.

The report provides insights on the following pointers:

Market Penetration:Comprehensive information on the product portfolios of the top players in the Machine Learning as a Service market.

Product Development/Innovation:Detailed insights on the upcoming technologies, R&D activities, and product launches in the market.

Competitive Assessment: In-depth assessment of the market strategies, geographic and business segments of the leading players in the market.

Market Development:Comprehensive information about emerging markets. This report analyzes the market for various segments across geographies.

Market Diversification:Exhaustive information about new products, untapped geographies, recent developments, and investments in the Machine Learning as a Service market.

Table of Contents

Global Machine Learning as a Service Market Research Report 2020 2026

Chapter 1 Machine Learning as a Service Market Overview

Chapter 2 Global Economic Impact on Industry

Chapter 3 Global Market Competition by Manufacturers

Chapter 4 Global Production, Revenue (Value) by Region

Chapter 5 Global Supply (Production), Consumption, Export, Import by Regions

Chapter 6 Global Production, Revenue (Value), Price Trend by Type

Chapter 7 Global Market Analysis by Application

Chapter 8 Manufacturing Cost Analysis

Chapter 9 Industrial Chain, Sourcing Strategy and Downstream Buyers

Chapter 10 Marketing Strategy Analysis, Distributors/Traders

Chapter 11 Market Effect Factors Analysis

Chapter 12 Global Machine Learning as a Service Market Forecast

Buy Exclusive Report @:

https://www.a2zmarketresearch.com/buy?reportId=64929

If you have any special requirements, please let us know and we will offer you the report as you want.

About A2Z Market Research:

The A2Z Market Research library provides syndication reports from market researchers around the world. Ready-to-buy syndication Market research studies will help you find the most relevant business intelligence.

Our Research Analyst Provides business insights and market research reports for large and small businesses.

The company helps clients build business policies and grow in that market area. A2Z Market Research is not only interested in industry reports dealing with telecommunications, healthcare, pharmaceuticals, financial services, energy, technology, real estate, logistics, F & B, media, etc. but also your company data, country profiles, trends, information and analysis on the sector of your interest.

Contact Us:

Roger Smith

1887 WHITNEY MESA DR HENDERSON, NV 89014

[emailprotected]

+1 775 237 4147

Visit link:
Comprehensive Report on Machine Learning as a Service Market Set to Witness Huge Growth by 2026 | Microsoft, International Business Machine, Amazon...

Machine Learning Shown to Identify Patient Response to Sarilumab in Rheumatoid Arthritis – AJMC.com Managed Markets Network

Machine learning was shown to identify patients with rheumatoid arthritis (RA) who present an increased chance of achieving clinical response with sarilumab, with those selected also showing an inferior response to adalimumab, according to an abstract presented at ACR Convergence, the annual meeting of the American College of Rheumatology (ACR).

In prior phase 3 trials comparing the interleukin 6 receptor (IL-6R) inhibitor sarilumab with placebo and the tumor necrosis factor (TNF-) inhibitor adalimumab, sarilumab appeared to provide superior efficacy for patients with moderate to severe RA. Although promising, the researchers of the abstract highlight that treatment of RA requires a more individualized approach to maximize efficacy and minimize risk of adverse events.

The characteristics of patients who are most likely to benefit from sarilumab treatment remain poorly understood, noted researchers.

Seeking to better identify the patients with RA who may best benefit from sarilumab treatment, the researchers applied machine learning to select from a predefined set of patient characteristics, which they hypothesized may help delineate the patients who could benefit most from either antiIL-6R or antiTNF- treatment.

Following their extraction of data from the sarilumab clinical development program, the researchers utilized a decision tree classification approach to build predictive models on ACR response criteria at week 24 in patients from the phase 3 MOBILITY trial, focusing on the 200-mg dose of sarilumab. They incorporated the Generalized, Unbiased, Interaction Detection and Estimation (GUIDE) algorithm, including 17 categorical and 25 continuous baseline variables as candidate predictors. These included protein biomarkers, disease activity scoring, and demographic data, added the researchers.

Endpoints used were ACR20, ACR50, and ACR70 at week 24, with the resulting rule validated through application on independent data sets from the following trials:

Assessing the end points used, it was found that the most successful GUIDE model was trained against the ACR20 response. From the 42 candidate predictor variables, the combined presence of anticitrullinated protein antibodies (ACPA) and C-reactive protein >12.3 mg/L was identified as a predictor of better treatment outcomes with sarilumab, with those patients identified as rule-positive.

These rule-positive patients, which ranged from 34% to 51% in the sarilumab groups across the 4 trials, were shown to have more severe disease and poorer prognostic factors at baseline. They also exhibited better outcomes than rule-negative patients for most end points assessed, except for patients with inadequate response to TNF inhibitors.

Notably, rule-positive patients had a better response to sarilumab but an inferior response to adalimumab, except for patients of the HAQ-Disability Index minimal clinically important difference end point.

If verified in prospective studies, this rule could facilitate treatment decision-making for patients with RA, concluded the researchers.

Reference

Rehberg M, Giegerich C, Praestgaard A, et al. Identification of a rule to predict response to sarilumab in patients with rheumatoid arthritis using machine learning and clinical trial data. Presented at: ACR Convergence 2020; November 5-9, 2020. Accessed January 15, 2021. 021. Abstract 2006. https://acrabstracts.org/abstract/identification-of-a-rule-to-predict-response-to-sarilumab-in-patients-with-rheumatoid-arthritis-using-machine-learning-and-clinical-trial-data/

See the article here:
Machine Learning Shown to Identify Patient Response to Sarilumab in Rheumatoid Arthritis - AJMC.com Managed Markets Network

8 Trending skills you need to be a good Python Developer – iLounge

Python, the general-purpose coding language has gained much popularity over the years. Speaking of web development, app designing, scientific computing or machine learning, Python has it all. Due to this favourability of Python in the market, python developers are also in high demand. They are required to be competent and out of the box thinkers- undoubtedly a race to win.

Are you one of those python developers? Do you find yourself lagging behind in proving your reliability? Maybe you are going wrong with some of your

skills. Never mind!

Im here to tell you of those 8 trendsetting skills you need to hone. Implement them and prove your expertise in the programming world. Come, lets take a look!

Being able to use the Python Library in its full potential also decides your expertise with this programming language. Python libraries like Panda, Matplotlib, Requests, Pyglet and more consist of reusable codes that youd wish to add to your programs. These libraries are boon to you as a developer. They will increase workflow and make task execution way easier. Nothing saves more time from having to write the whole code every time.

You might know how Python omits repeated code by using pre-developed frameworks. As a developer using a Python framework, you typically write code which conforms to some kind of conventions. Because of which it becomes easy to delegate responsibilities for the communications, infrastructure and low-level stuff to the framework. You can, therefore, concentrate on the logic of the application in your own code. If you have a good knack of these Python frameworks it can be a blessing, as it allows smooth flow of development. You may not know them all, but its advisable to keep up with some popular ones like Flask, Django and CherryPy.

Not sure of Python frameworks? You can seek help from Python Training Courses.

Object-relational mapping (ORM) is a programming method used to access a database. It exposes your database into a series of objects without writing commands to insert or retrieve data. It may sound complex, but can save you a lot of time, and help to control access to your database. ORM tools can also be customised by a Python developer.

Front end technologies like the HTML5, CSS3, and JavaScript will help you collaborate and work with a team of designers, marketers and other developers. Again, this can save a lot of development time.

A good Python developer should have sharp analytical skills. You are expected to observe and critically come up with complex ideas, solutions or decisions about coding. Talking of the analytical skills in Python you need to have:

Analytical skills are a mark of your additional knowledge in the field. Building your analytical skills also make you a better problem solver.

Python Developers have a bright future in Data Science. Companies on the run will prefer developers with Data Science knowledge to create innovative tech solutions. Knowing Python will also gain your knowledge of probability, statistics, data wrangling and SQL. All of these are significant aspects of Data Science.

Python is the right choice to grow in the Artificial Intelligence and Machine learning domain. It is an intuitive and minimalistic language with a full-featured library line (also called frameworks) which considerably reduces the time required to get your first results.

However, to master artificial intelligence and machine learning with Python you need to have a strong command over Python syntax. A fair grounding with calculus, data science and statistics can make you a pro. If you are a beginner, you can gain expertise in these areas by brushing up your math skills for Python Mathematical Libraries. Gradually, you can acquire your adequate Machine Learning skills by building simple neutral networks.

In the coming years, deep learning professionals will be well-positioned as there is a huge possibility awaiting in this field. With Python, you should be able to easily develop and evaluate deep learning models. Since deep learning is the advanced model of Machine Learning, to be able to bring it into complete functionality you should first get hands-on:

A good python developer is also a mixture of several soft skills like proactivity, communication and time management. Most of all, a career as a Python Developer is challenging, but at the same time interesting. Empowering yourself with these skill sets is sure to take you a long way. Push yourself from the comfort zone and work hard from today!

See the rest here:
8 Trending skills you need to be a good Python Developer - iLounge

Google’s Blob Opera combines machine learning with animated operatics – Newstalk ZB

With school out for the year and many taking their summer break, many families will be looking for something fun to do over the next few weeks.

Google's latest machine-learning game may be one way to pass the time, thanks to Blob Opera.

Four actual opera singers Christian Joel (tenor), Frederick Tong (bass), Joanna Gamble (mezzosoprano), and Olivia Doutney (soprano) recorded 16 hours of singing and their voices were used to train amachine learning model to create an algorithm for whatopera sounds like mathematically.

The algorithm was then combined with for very cute blob characters which represent the different opera voice typesand you can move them around to make them sing different notes. The algorithm then does it's magic and calculates how the other 3 blobs should sing to perfectly harmonise with your blob allowing you to compose opera of your own without having to sing a note!

Michelle Dickinson joined Francesca Rudkin to explain what this means.

LISTEN ABOVE

View post:
Google's Blob Opera combines machine learning with animated operatics - Newstalk ZB

CERC plans to embrace AI, machine learning to improve functioning – Business Standard

The apex power sector regulator, the Central Electricity Regulatory Commission (CERC), is planning to set up an artificial intelligence (AI)-based regulatory expert system tool (REST) for improving access to information and assist the commission in discharge of its duties. So far, only the Supreme Court (SC) has an electronic filing (e-filing) system and is in the process of building an AI-based back-end service.

The CERC will be the first such quasi-judicial regulatory body to embrace AI and machine learning (ML). The decision comes at a time when the CERC has been shut for four ...

Key stories on business-standard.com are available to premium subscribers only.

MONTHLY STAR

Business Standard Digital Monthly Subscription

Complete access to the premium product

Convenient - Pay as you go

Pay using Master/Visa Credit Card & ICICI VISA Debit Card

Auto renewed (subject to your card issuer's permission)

Cancel any time in the future

Note: Subscription will be auto renewed, you may cancel any time in the future without any questions asked.

Requires personal information

SMART MONTHLY

Business Standard Digital - 12 Months

Get 12 months of Business Standard digital access

Single Seamless Sign-up to Business Standard Digital

Convenient - Once a year payment

Pay using an instrument of your choice - Credit/Debit Cards, Net Banking, Payment Wallets accepted

Exclusive Invite to select Business Standard events

Note: Subscription will be auto renewed, you may cancel any time in the future without any questions asked.

Business Standard has always strived hard to provide up-to-date information and commentary on developments that are of interest to you and have wider political and economic implications for the country and the world. Your encouragement and constant feedback on how to improve our offering have only made our resolve and commitment to these ideals stronger. Even during these difficult times arising out of Covid-19, we continue to remain committed to keeping you informed and updated with credible news, authoritative views and incisive commentary on topical issues of relevance.We, however, have a request.

As we battle the economic impact of the pandemic, we need your support even more, so that we can continue to offer you more quality content. Our subscription model has seen an encouraging response from many of you, who have subscribed to our online content. More subscription to our online content can only help us achieve the goals of offering you even better and more relevant content. We believe in free, fair and credible journalism. Your support through more subscriptions can help us practise the journalism to which we are committed.

Support quality journalism and subscribe to Business Standard.

Digital Editor

First Published: Fri, January 15 2021. 06:10 IST

Read the original:
CERC plans to embrace AI, machine learning to improve functioning - Business Standard