DNA profiling is frequently in the news. Public interest is sparked when DNA is used to identify a suspect or human remains, or resolves a cold case that seems all but forgotten.
Very occasionally, it is in the media when the process doesnt work as it should.
ADVERTISEMENT
CONTINUE READING BELOW
So what is DNA profiling and how does it work and why does it sometimes not work?
DNA profiling, as it has been known since 1994, has been used in the criminal justice system since the late 1980s, and was originally termed DNA fingerprinting.
The DNA in every human is very similar up to 99.9% identical, in fact. But strangely, about 98% of the DNA in our cells is not gene-related (i.e. has no known function).
This non-coding DNA is largely comprised of sequences of the four bases that make up the DNA in every cell.
But for reasons unknown, some sections of the sequence are repeated: an example is TCTATCTATCTATCTATCTA where the sequence TCTA is repeated five times. While the number of times this DNA sequence is repeated is constant within a person, it can vary between people. One person might have 5 repeats but another 6, or 7 or 8.
ADVERTISEMENT
CONTINUE READING BELOW
There are a large number of variants and all humans fall into one of them. The detection of these repeats is the bedrock of modern DNA profiling. A DNA profile is a list of numbers, based on the repeated sequences we all have.
The use of these short repeat sequences (the technical term is short tandem repeat or STR) started in 1994 when the UK Forensic Science Service identified four of these regions. The chance that two people taken at random in the population would share the same repeat numbers at these four regions was about 1 in 50,000.
Now, the number of known repeat sequences has expanded greatly, with the latest test looking at 24 STR regions. Using all of the known STR regions results in an infinitesimally small probability that any two random people have the same DNA profile. And herein lies the power of DNA profiling.
The repeat sequence will be the same in every cell within a person thus, the DNA profile from a blood sample will be the same as from a plucked hair, inside a tooth, saliva, or skin. It also means a DNA profile will not in itself indicate from what type of tissue it originated.
Consider a knife alleged to be integral to an investigation. A question might be who held the knife? A swab (cotton or nylon) will be moistened and rubbed over the handle to collect any cells present.
ADVERTISEMENT
CONTINUE READING BELOW
The swab will then be placed in a tube containing a cocktail of chemicals that purifies the DNA from the rest of the cellular material this is a highly automated process. The amount of DNA will then be quantified.
If there is sufficient DNA present, we can proceed to generate a DNA profile. The optimum amount of DNA needed to generate the profile is 500 picograms this is really tiny and represents only 80 cells!
DNA profiling is highly sensitive, given it can work from only 80 cells. This is microscopic: the tiniest pinprick of blood holds thousands of blood cells.
Consider said knife if it had been handled by two people, perhaps including a legitimate owner and a person of interest, yet only 80 cells are present, those 80 cells would not be from only one person but two. Hence there is now a less-than-optimal amount of DNA from either of the people, and the DNA profiling will be a mixture of the two.
Fortunately, there are several types of software to pull apart these mixed DNA profiles. However, the DNA profile might be incomplete (the term for this is partial); with less DNA data, there will be a reduced power to identify the person.
ADVERTISEMENT
CONTINUE READING BELOW
Worse still, there may be insufficient DNA to generate any meaningful DNA profile at all. If the sensitivity of the testing is pushed further, we might obtain a DNA profile from even a few cells. But this could implicate a person who may have held the knife innocently weeks prior to an alleged event; or be from someone who shook hands with another person who then held the knife.
This later event is called indirect transfer and is something to consider with such small amounts of DNA.
In forensics, using DNA means comparing a profile from a sample to a reference profile, such as taken from a witness, persons of interest, or criminal DNA databases.
By itself, a DNA profile is a set of numbers. The only thing we can figure out is whether the owner of the DNA has a Y-chromosome that is, their biological sex is male.
A standard STR DNA profile does not indicate anything about the persons appearance, predisposition to any diseases, and very little about their ancestry.
ADVERTISEMENT
CONTINUE READING BELOW
Other types of DNA testing, such as ones used in genealogy, can be used to associate the DNA at a crime scene to potential genetic relatives of the person but current standard STR DNA profiling will not link to anyone other that perhaps very close relatives parents, offspring, or siblings.
DNA profiling has been, and will continue to be, an incredibly powerful forensic test to answer whose biological material is this? This is its tremendous strength. As to how and when that material got there, thats for different methods to sort out.
Adrian Linacre, Professor of Forensic Genetics, Flinders University
This article is republished from The Conversation under a Creative Commons license. Read the original article.
Also Read | DART: NASAs crash was successful in shifting an asteroids orbit
ADVERTISEMENT
CONTINUE READING BELOW
Latest Stories
Read this article:
DNA is often used in solving crimes. But how does DNA profiling work? - EastMojo
- Discovering the mysteries of human DNA - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Scientists go deeper into DNA - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Instant Egghead - Genes vs. DNA vs. Chromosomes - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- DNA Calls Out Lineup Of Rappers For Future Battles - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- What is DNA? - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Turn Your DNA Into Fine Art, BMW Zagato Roadster - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- DNA - OFFICIAL URLTV SUMMER MADNESS 2 RECAP! - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- "Binary DNA" - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- 16x9 - DNA Prophecies: Code reveals your future - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Gilbert Gottfried - Space DNA, Sexy Weight Loss, Badonkadonk Booty - Gilbert Gets It - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Animated Health Video Production | DNA Services of America - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Michael Tsarion ~ Mayans ~ 2012 ~ DNA - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Mini-drones to take your DNA? - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- C2CAM - DNA Research - 07-09-2012 - Coast To Coast AM - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Inside The DNA Of MDNA - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- KOTD - Rap Battle - DNA vs Eurgh - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Starchild DNA Showing "Wright" Stuff - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- Chrome Cats - DNA of a Winner(Official Video) - Video [Last Updated On: September 7th, 2012] [Originally Added On: September 7th, 2012]
- DNA leads to arrest in 1980 murder of Oxnard girl [Last Updated On: September 8th, 2012] [Originally Added On: September 8th, 2012]
- 'Junk' DNA: Not So Useless After All [Last Updated On: September 8th, 2012] [Originally Added On: September 8th, 2012]
- Decoding Human DNA [Last Updated On: September 9th, 2012] [Originally Added On: September 9th, 2012]
- Planet of the Apes: What is that big hunk of 'junk' DNA up to ? [Last Updated On: September 10th, 2012] [Originally Added On: September 10th, 2012]
- Genetics Breakthrough Changes Thinking About DNA [Last Updated On: September 11th, 2012] [Originally Added On: September 11th, 2012]
- 'Junk DNA' and the mystery of mankind's missing genes [Last Updated On: September 11th, 2012] [Originally Added On: September 11th, 2012]
- Real-time observation of single DNA molecule repair [Last Updated On: September 12th, 2012] [Originally Added On: September 12th, 2012]
- Court hears DNA findings in child sex case [Last Updated On: September 12th, 2012] [Originally Added On: September 12th, 2012]
- 2012 International Symposium on Human Identification Features Emerging and Best Practice Forensic DNA Techniques ... [Last Updated On: September 12th, 2012] [Originally Added On: September 12th, 2012]
- DNA could help ID a king [Last Updated On: September 13th, 2012] [Originally Added On: September 13th, 2012]
- DNA with a Twist [Last Updated On: September 13th, 2012] [Originally Added On: September 13th, 2012]
- Three reasons to like junk DNA [Last Updated On: September 13th, 2012] [Originally Added On: September 13th, 2012]
- LBNL Seeks Licensees for Highly Specific and Sensitive DNA Extraction Method [Last Updated On: September 13th, 2012] [Originally Added On: September 13th, 2012]
- Under-twisted DNA origami delivers cancer drugs to tumors [Last Updated On: September 13th, 2012] [Originally Added On: September 13th, 2012]
- DNA ‘junk' contains a treasure of information about disease [Last Updated On: September 14th, 2012] [Originally Added On: September 14th, 2012]
- Research: Hopping DNA supercoils [Last Updated On: September 14th, 2012] [Originally Added On: September 14th, 2012]
- DNA evidence missing in Assange case [Last Updated On: September 16th, 2012] [Originally Added On: September 16th, 2012]
- Missing DNA evidence in Assange case [Last Updated On: September 16th, 2012] [Originally Added On: September 16th, 2012]
- No Assange DNA on torn condom - report [Last Updated On: September 16th, 2012] [Originally Added On: September 16th, 2012]
- Calif. DNA Collection From Arrestees Challenged [Last Updated On: September 17th, 2012] [Originally Added On: September 17th, 2012]
- Federal appeals court to hear challenge to California DNA collection law [Last Updated On: September 17th, 2012] [Originally Added On: September 17th, 2012]
- Applied DNA Sciences Contracts With Inventionland [Last Updated On: September 18th, 2012] [Originally Added On: September 18th, 2012]
- Applied DNA Sciences, Textile Centre of Excellence Unveil Textiles Anti-Counterfeiting Platform [Last Updated On: September 18th, 2012] [Originally Added On: September 18th, 2012]
- Rapist caught by DNA test jailed [Last Updated On: September 18th, 2012] [Originally Added On: September 18th, 2012]
- FBI eager to embrace mobile 'Rapid DNA' testing [Last Updated On: September 19th, 2012] [Originally Added On: September 19th, 2012]
- Expansion of criminal DNA collection proposed [Last Updated On: September 19th, 2012] [Originally Added On: September 19th, 2012]
- Assessment of HPV DNA Alone Insufficient to Identify HPV-Driven Head and Neck Cancers [Last Updated On: September 19th, 2012] [Originally Added On: September 19th, 2012]
- George Zimmerman's DNA, not Trayvon Martin's, found on gun [Last Updated On: September 20th, 2012] [Originally Added On: September 20th, 2012]
- George Zimmerman: No DNA evidence of a struggle for his gun [Last Updated On: September 20th, 2012] [Originally Added On: September 20th, 2012]
- DNA evidence links Vallejo man to January stabbing in SLO, police say [Last Updated On: September 20th, 2012] [Originally Added On: September 20th, 2012]
- Legal hurdles threaten to slow FBI's 'Rapid DNA' revolution [Last Updated On: September 21st, 2012] [Originally Added On: September 21st, 2012]
- Judge denies motions to dismiss DNA evidence in Hudson murder case [Last Updated On: September 22nd, 2012] [Originally Added On: September 22nd, 2012]
- Researchers report novel approach for single molecule electronic DNA sequencing [Last Updated On: September 22nd, 2012] [Originally Added On: September 22nd, 2012]
- Novel approach for single molecule electronic DNA sequencing [Last Updated On: September 22nd, 2012] [Originally Added On: September 22nd, 2012]
- DNA helps Wyckoff police nab 'motorcycle burglar' [Last Updated On: September 22nd, 2012] [Originally Added On: September 22nd, 2012]
- Novel DNA barcode engineered: New technology could launch biomedical imaging to next level [Last Updated On: September 25th, 2012] [Originally Added On: September 25th, 2012]
- DNA Microarray 2012: A Focus on Sales Growth [Last Updated On: September 25th, 2012] [Originally Added On: September 25th, 2012]
- DNA in 1980 Maine murder case shown to match defendant [Last Updated On: September 25th, 2012] [Originally Added On: September 25th, 2012]
- DNA recovered during Rayney probe [Last Updated On: September 26th, 2012] [Originally Added On: September 26th, 2012]
- FBI makes headway on DNA testing backlog, report says [Last Updated On: September 26th, 2012] [Originally Added On: September 26th, 2012]
- Male DNA found for first time in female brains [Last Updated On: September 27th, 2012] [Originally Added On: September 27th, 2012]
- Bearing Sons Leaves Male DNA Traces in Mom's Brain [Last Updated On: September 28th, 2012] [Originally Added On: September 28th, 2012]
- Many female brains contain male DNA [Last Updated On: September 28th, 2012] [Originally Added On: September 28th, 2012]
- New drive to take criminals' DNA [Last Updated On: September 28th, 2012] [Originally Added On: September 28th, 2012]
- DNA remains focus in Highway of Tears cases [Last Updated On: September 28th, 2012] [Originally Added On: September 28th, 2012]
- Analysing The Evidence On DNA [Last Updated On: September 29th, 2012] [Originally Added On: September 29th, 2012]
- DNA Clears Death Row Inmate [Last Updated On: September 29th, 2012] [Originally Added On: September 29th, 2012]
- Burn victim identified by DNA in maggots [Last Updated On: September 29th, 2012] [Originally Added On: September 29th, 2012]
- DNA fails to match couple on two other skeletons [Last Updated On: September 29th, 2012] [Originally Added On: September 29th, 2012]
- DNA Dynamics Update on Sports Title [Last Updated On: September 30th, 2012] [Originally Added On: September 30th, 2012]
- DNA solves teen's 1974 murder [Last Updated On: September 30th, 2012] [Originally Added On: September 30th, 2012]
- Some Women's Brains Contain Male DNA: Study [Last Updated On: September 30th, 2012] [Originally Added On: September 30th, 2012]
- DNA exonerates man after 15 years on death row - Video [Last Updated On: September 30th, 2012] [Originally Added On: September 30th, 2012]
- DNA link prompts charges in cold case rapes - Video [Last Updated On: September 30th, 2012] [Originally Added On: September 30th, 2012]
- DNA testing has its limits [Last Updated On: October 1st, 2012] [Originally Added On: October 1st, 2012]
- DNA evidence exonerates 300th prisoner nationwide [Last Updated On: October 1st, 2012] [Originally Added On: October 1st, 2012]
- DNA testing facility in Pune to speed up cases in Mumbai [Last Updated On: October 1st, 2012] [Originally Added On: October 1st, 2012]
- Rape DNA process 'not adequate' [Last Updated On: October 2nd, 2012] [Originally Added On: October 2nd, 2012]
- IntegenX Announces U.S. Launch of the RapidHIT™ 200 System – Rapid DNA Technology That Will Revolutionize the Use of ... [Last Updated On: October 2nd, 2012] [Originally Added On: October 2nd, 2012]
- 300th person exonerated by DNA evidence [Last Updated On: October 2nd, 2012] [Originally Added On: October 2nd, 2012]
- Inherited Diseases Found Sooner in Newborns With DNA Scan [Last Updated On: October 3rd, 2012] [Originally Added On: October 3rd, 2012]
- Woman charged in husband's death gives DNA sample [Last Updated On: October 3rd, 2012] [Originally Added On: October 3rd, 2012]







